Anteaeolidiella lurana

(Ev.Marcus & Er.Marcus, 1967) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Aeolidiidae/Anteaeolidiella

At a glance

Occurrence records153

Data sources7

Biological traits2

DNA specimens10

eDNA detections11

Sources7 archives

Databases and archives Anteaeolidiella lurana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

OBISOcean Biodiversity Information System7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS153 records

Environmental DNA2 datasets · 6 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anteaeolidiella lurana, is a species of sea slug, an aeolid nudibranch. It is a marine gastropod mollusc in the family Aeolidiidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anteaeolidiella lurana has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections11

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.92%

Where individuals differ — all 6 variable positions, in barcode order

55Cmostly conserved

85Cmostly conserved

337Amostly conserved

539Tmostly conserved

562Cmostly conserved

646Tmostly conserved

GACACTTTATGTGCTCTTAGGGATGTGATGTGGATTAGCAGGGACAGGTCTAAGCTTACTTATTCGTTTTGAATTAGGAACTGCCGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anteaeolidiella takanosimensissame genus12.8%Berghia norvegicasame family16.5%Doto millbayanasame order16.8%Eubranchus horiisame order16.9%Doto dunneisame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor142

Museum / vouchered11

Range

Area of Occupancy AOO196 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4 m · max 10.7 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 54≤1 km 53≤10 km 3>10 km 2

112 georeferenced · 30 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Nacional de Ciencias Naturales (CSIC)location not on record	2
CASlocation not on record	2
ARMS-MBONlocation not on record	1
Chicago, US	1

4 institutions · 6 of 11 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Anteaeolidiella lurana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys2

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map6 countries0

Marina/Harbour; semi-industrial; 9.6 - Subti…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 14.0–24.2

Seasonal swing summer↔winter14.4 °C

Max temp (day)22.0 °C 17.9–28.8

Min temp (night)15.0 °C 8.80–19.8

Precipitation37.7 mm/mo 15.6–130

Air humidity58.3 % 43.4–63.7

Moisture balance-63.1 mm/mo

Vapour deficit884 Pa 730–1,624

Wind speed3.90 m/s

Cloud cover34.9 % 17.9–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)