Antarctinoe ferox

(Baird, 1865) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Phyllodocida/Polynoidae/Antarctinoe

At a glance

Occurrence records133

Data sources7

Biological traits3

DNA specimens13

eDNA detections17

Sources7 archives

Databases and archives Antarctinoe ferox's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

OBISOcean Biodiversity Information System57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS133 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD13 specimens

01Narrative

Antarctinoe ferox is een borstelworm uit de familie Polynoidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Antarctinoe ferox werd in 1865 voor het eerst wetenschappelijk beschreven door Baird.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth max222 m

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antarctinoe ferox has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

32Gmostly conserved

108Gmostly conserved

162Gvariable

180Gmostly conserved

216Gvariable

234Tvariable

264Cmostly conserved

294Avariable

321Amostly conserved

342Cmostly conserved

402Tvariable

495Amostly conserved

618Tmostly conserved

627Cmostly conserved

ACCTTGTACTTCATTTTTGGCACTTGATCAGGTCTTTTAGGCACTTCAATAAGACTTCTTATTCGTGCTGAATTAGGGCAGCCCGGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes6

BIN1

Most divergent pair1.1%

OtherAntarctica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Harmothoe fuligineumsame family3.5%Gorekia crassicirrissame family10.4%Polyeunoa laevissame family15.9%Neopolynoe paradoxasame family16.1%Harmothoe fragilissame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type133 records

Wild obs. + sensor51

Museum / vouchered80

Other2

Origin

Native5

Range

Area of Occupancy AOO256 km²

Depth

0–200 m sunlit5

200–1000 m twilight50

1–4 km midnight1

>4 km abyssal0

median 449 m · max 1 080.6 m · 56 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 8≤1 km 26>10 km 2

36 georeferenced · 15 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 80 records without

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Earth Sciences New Zealandlocation not on record	28
South Kensington, GB	7
Frankfurt am Main	2

3 institutions · 37 of 80 vouchered records shown · 6 without an institution code

09Environmental DNA17 detections

Where the DNA of Antarctinoe ferox was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-8.50 °C -13.4–1.00

Seasonal swing summer↔winter19.8 °C

Max temp (day)-7.10 °C -11.9–1.60

Min temp (night)-10.4 °C -14.9–0.4

Precipitation42.7 mm/mo 18.9–58.5

Air humidity66.8 % 53.3–70.6

Vapour deficit149 Pa 96.2–224

Cloud cover61.1 % 51.4–67.4

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)