Antaeotricha renselariana

Stoll, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Antaeotricha

At a glance

Occurrence records58

Data sources7

Biological traits0

DNA specimens318

eDNA detections327

Sources7 archives

Databases and archives Antaeotricha renselariana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI327 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics318 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 1 countries327 detections

DNA & barcodingBOLD318 specimens

01Narrative

Antaeotricha renselariana is a moth in the family Depressariidae. It was described by Caspar Stoll in 1781. It is found in Panama, Surinam, French Guiana, Brazil (Amazonas, Para, Bahia) and Peru."Antaeotricha Zeller, 1854" at Markku Savela's Lepidoptera and Some Other Life Forms.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding318 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaeotricha renselariana has left across the world's sequence archives.

At a glance

DNA specimens318

BINs2

Marker genes1

eDNA detections327

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus315 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

160Gmostly conserved

181Gmostly conserved

220Cmostly conserved

388Amostly conserved

646Tmostly conserved

AACATTATACTTTATTTTCGGAATTTGAGCGGGAATAGTTGGTACTTCCCTTAGTTTATTAATCCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes9

BINs2

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Artiastis tepidasame order10.2%Dircenna derosame order10.2%Prepocosma tropicasame order10.2%Ethmia miriamschulmanaesame family10.3%Pancalia schwarzellasame order10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor35

Museum / vouchered23

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 13≤1 km 7≤10 km 7>10 km 2

29 georeferenced · 6 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Pennsylvanialocation not on record	3

1 institutions · 3 of 23 vouchered records shown · 20 without an institution code

09Environmental DNA327 detections

Where the DNA of Antaeotricha renselariana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found327

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 327 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 21.9–25.6

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.7 °C 25.3–28.2

Min temp (night)21.6 °C 19.5–23.4

Precipitation273 mm/mo 65.5–478

Air humidity70.8 % 65.0–75.7

Moisture balance149 mm/mo -98.3–344

Vapour deficit817 Pa 700–1,120

Wind speed2.00 m/s 1.00–3.60

Cloud cover31.3 % 15.1–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 312 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)