Antaeotricha phaeoneura

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Antaeotricha

At a glance

Occurrence records7

Data sources4

Biological traits0

DNA specimens32

eDNA detections32

Sources4 archives

Databases and archives Antaeotricha phaeoneura's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 1 countries32 detections

DNA & barcodingBOLD32 specimens

01Narrative

Antaeotricha phaeoneura is a moth in the family Depressariidae. It was described by Edward Meyrick in 1913. It is found in Guyana."Antaeotricha Zeller, 1854" at Markku Savela's Lepidoptera and Some Other Life Forms. The wingspan is about 29 mm. The forewings are ochreous-white and with all veins marked with fuscous lines. The submedian space is tinged with pale greyish-ochreous, the dorsal space suffused with ochreous-grey. The hindwings are pale grey.Transactions of the Entomological Society of London 1913 (1): 187

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaeotricha phaeoneura has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections32

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACATCTCTTAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antaeotricha marmoreasame genus8.5%Aedia leucomelassame order9.0%Leuciris fimbriariasame order9.1%Schinia hulstiasame order9.1%Compsotropha seleniassame order9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Museum / vouchered7

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

10Collections & institutions

Institution	Specimens
University of Pennsylvanialocation not on record	2

1 institutions · 2 of 7 vouchered records shown · 5 without an institution code

09Environmental DNA32 detections

Where the DNA of Antaeotricha phaeoneura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.1–25.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.7 °C 25.5–29.2

Min temp (night)21.8 °C 21.0–21.9

Precipitation420 mm/mo 65.5–478

Air humidity74.7 % 64.9–76.3

Moisture balance291 mm/mo -98.3–344

Vapour deficit743 Pa 700–1,120

Wind speed1.50 m/s 1.00–2.30

Cloud cover34.2 % 16.1–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)