Antaeotricha humilis

Zeller, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Antaeotricha

At a glance

Occurrence records1 089

Data sources7

Biological traits0

DNA specimens50

eDNA detections58

Sources7 archives

Databases and archives Antaeotricha humilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 089 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 089 records

Environmental DNA1 datasets · 2 countries58 detections

DNA & barcodingBOLD50 specimens

01Narrative

Antaeotricha humilis, the dotted anteotricha moth, is a moth in the family Depressariidae. It was described by Philipp Christoph Zeller in 1855. It is found in North America, where it has been recorded from Alabama, Arkansas, Florida, Georgia, Illinois, Indiana, Kansas, Kentucky, Louisiana, Maryland, Mississippi, New Jersey, North Carolina, Ohio, Oklahoma, South Carolina, Tennessee, Texas, Virginia and West Virginia."Antaeotricha Zeller, 1854" at Markku Savela's Lepidoptera and Some Other Life Forms. The wingspan is about 14 mm.mothphotographersgroup Adults are greyish, almost white with obscure patches of very pale fuscous on the forewings. There is a small brown spot within the dorsal margin, before the middle and another a little behind it on the fold, and yet another at the end of the disc.Description of Harpalyce canusella in The Canadian Entomologist 6 (12): 235 The larvae feed on Quercus species, tying the leaves of their host plant.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaeotricha humilis has left across the world's sequence archives.

At a glance

DNA specimens50

BINs2

Marker genes1

eDNA detections58

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

70Gmostly conserved

100Cvariable

247Cmostly conserved

271Tmostly conserved

316Amostly conserved

511Amostly conserved

616Cmostly conserved

AACACTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGTACATCTCTTAGTTTATTAATTCGAGCGGAGTTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes19

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Barantola panaristasame family11.1%Anaptilora homoclerasame order11.2%Nausinoe geometralissame order11.4%Latoia viridifasciasame order11.6%Artiastis heliacmasame order11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 089 records

Wild obs. + sensor816

Museum / vouchered273

Range

Area of Occupancy AOO1 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 393≤1 km 148≤10 km 25>10 km 45

611 georeferenced · 205 without coordinates

Open the mapobservation + sensor816

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 3≤1 km 5≤10 km 42>10 km 8

58 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence273

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	164
CUlocation not on record	17
North Carolina State University Insect Museumlocation not on record	15
East Lansing, US	13
Georgia Museum of Natural Historylocation not on record	13
Washington, US	8
University of California, Davislocation not on record	5
Cambridge, US	2
San Francisco, US	2
King Saud Universitylocation not on record	1
Cornell University Insect Collectionlocation not on record	1
University of Alberta Museums (UAM)location not on record	1

12 institutions · 242 of 273 vouchered records shown · 31 without an institution code

09Environmental DNA58 detections

Where the DNA of Antaeotricha humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 12.6–21.8

Seasonal swing summer↔winter19.8 °C

Max temp (day)19.6 °C 17.8–24.7

Min temp (night)9.50 °C 7.20–18.2

Precipitation138 mm/mo 105–146

Air humidity60.0 % 58.2–60.2

Moisture balance9.80 mm/mo -41.8–22.3

Vapour deficit669 Pa 579–1,046

Wind speed2.60 m/s 2.20–4.10

Cloud cover38.8 % 32.7–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antaeotricha humilis

At a glance

Sources7 archives

At a glance

Record type1 089 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 089 records