Anotylus hamatus

(Fairmaire & Laboulbène, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Anotylus

At a glance

Occurrence records208

Data sources5

Biological traits2

DNA specimens68

eDNA detections1

Sources5 archives

Databases and archives Anotylus hamatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility208 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF208 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD68 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anotylus hamatus has left across the world's sequence archives.

At a glance

DNA specimens68

BINs1

Marker genes16

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)6.0%

Haplotypes2

BIN1

Most divergent pair12.2%

Where individuals differ — all 113 variable positions, in barcode order

5Cmostly conserved

9Tmostly conserved

11Tmostly conserved

12Amostly conserved

14Tvariable

20Gmostly conserved

27Tmostly conserved

29Avariable

32Avariable

35Amostly conserved

38Avariable

59Tmostly conserved

62Cmostly conserved

68Amostly conserved

72Cmostly conserved

74Amostly conserved

77Amostly conserved

78Tmostly conserved

80Cmostly conserved

83Amostly conserved

86Avariable

98Cvariable

101Cmostly conserved

116Tmostly conserved

122Tmostly conserved

137Amostly conserved

141Amostly conserved

143Tmostly conserved

149Tmostly conserved

152Tmostly conserved

161Tmostly conserved

167Avariable

170Tmostly conserved

171Gmostly conserved

176Cmostly conserved

179Gvariable

182Amostly conserved

185Tmostly conserved

188Amostly conserved

191Tmostly conserved

194Amostly conserved

195Cmostly conserved

200Tmostly conserved

204Tmostly conserved

210Cmostly conserved

215Gmostly conserved

218Cmostly conserved

221Amostly conserved

227Amostly conserved

233Cmostly conserved

236Cmostly conserved

245Tmostly conserved

257Tmostly conserved

266Avariable

272Tmostly conserved

275Tmostly conserved

282Tmostly conserved

308Avariable

314Avariable

317Cvariable

332Amostly conserved

341Cvariable

345Cmostly conserved

350Amostly conserved

353Tmostly conserved

362Cvariable

371Amostly conserved

384Cmostly conserved

389Cmostly conserved

401Cvariable

404Cmostly conserved

425Cmostly conserved

428Gmostly conserved

431Gmostly conserved

434Tmostly conserved

440Cvariable

455Tmostly conserved

476Tmostly conserved

488Cvariable

491Gvariable

497Cmostly conserved

506Gmostly conserved

509Amostly conserved

512Amostly conserved

518Tmostly conserved

524Cmostly conserved

525Gmostly conserved

530Cmostly conserved

534Tmostly conserved

536Amostly conserved

539Tmostly conserved

546Cmostly conserved

548Amostly conserved

551Tmostly conserved

554Amostly conserved

560Amostly conserved

563Gmostly conserved

566Tmostly conserved

572Cmostly conserved

581Tmostly conserved

584Tmostly conserved

587Cvariable

602Cvariable

611Cvariable

614Cmostly conserved

617Amostly conserved

620Amostly conserved

626Avariable

632Cvariable

635Avariable

641Amostly conserved

644Cvariable

650Cmostly conserved

CCCTCTACTTTATTTTTGGGGCTTGATCAGGAATAGTAGGCACATCCCTAAGAATACTTATCCGAGCAGAACTAGGATCCCCAGGATCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anotylus saulcyisame genus13.9%Carpelimus halophilussame family15.1%Anotylus rugosussame genus15.3%Carpelimus fuliginosussame family16.0%Bledius mandibularissame family16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5Patp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND612SMT-NADH5

animal barcoderibosomalmitochondrialmarker

08Occurrence & distribution

Record type208 records

Wild obs. + sensor66

Museum / vouchered142

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 39≤1 km 17≤10 km 6

62 georeferenced · 4 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 66≤1 km 24≤10 km 35>10 km 9

134 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	38
Akademia Pomorska w Słupskulocation not on record	34
Olocation not on record	16
NHMOlocation not on record	14
Helsinki, FI	5
NTNU-VMlocation not on record	4
Oulu, FI	4
NMBU:MINAlocation not on record	2
BioFokuslocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
South Kensington, GB	2
Bavarian State Collection of Zoologylocation not on record	1
neflocation not on record	1

13 institutions · 125 of 142 vouchered records shown · 17 without an institution code

09Environmental DNA1 detections

Where the DNA of Anotylus hamatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)