Anotopterus nikparini

Kukuev, 1998 · species

image placeholder — illustration coming later

Animalia/Chordata/Aulopiformes/Anotopteridae/Anotopterus

At a glance

Occurrence records74

Data sources9

Biological traits7

DNA specimens3

eDNA detections0

Sources9 archives

Databases and archives Anotopterus nikparini's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

OBISOcean Biodiversity Information System36 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS74 records

DNA & barcodingBOLD3 specimens

01Narrative

Anotopterus nikparini is a species of fish in the family Anotopteridae, the daggertooths. It is native to the northern Pacific Ocean, where it occurs as far north as the Bering Sea and as far south as Japan and Baja California.Froese, R. and D. Pauly, Editors. Anotopterus nikparini. FishBase. 2015. This fish can be found near the surface to depths below 2000 meters. Populations in colder regions are mainly larger, older adults. This species feeds on molluscs, crustaceans, marine worms, salps, and fish. It is an important predator of Pacific salmon.Nagasawa, K., Azumaya, T., & Yoshida, Y. (2002). (Nagasawa).pdf Impact of predation by salmon sharks (Lamna ditropis) and daggertooth (Anotopterus nikparini) on Pacific salmon (Oncorhynchus spp.) stocks in the North Pacific Ocean. NPAFC Technical Report No. 4. In turn, it is a prey item for whales and large fish such as albacore, lancetfish, halibut, steelhead, pomfret, and blue shark.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length146 cm

Body mass1 650 g

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max2 750 m

Depth min0 m

Vulnerability87.6

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anotopterus nikparini has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

265Cvariable

550Tvariable

553Tvariable

643Cvariable

CCTGTATCTTCTATTCGGTGCCTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTTTTAATCCGGGCAGAACTTAGCCAACCCGGGGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anotopterus pharaosame genus1.5%Roeboides sazimaisame order17.6%Apodemus flavicollissame order17.6%Sudis atroxsame family17.6%Myotis nattererisame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~2.38 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin2.38 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type74 records

Wild obs. + sensor53

Museum / vouchered21

Origin

Native3

Range

Area of Occupancy AOO104 km²

Depth

0–200 m sunlit27

200–1000 m twilight1

1–4 km midnight2

>4 km abyssal0

median 16.1 m · max 1 889.5 m · 30 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 49>10 km 1

50 georeferenced · 3 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UWFClocation not on record	3
University of California San Diegolocation not on record	3
Oregon State Universitylocation not on record	2
FishBaselocation not on record	1

4 institutions · 9 of 21 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)