Anotia bonnetii

Kirby, 1821 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Derbidae/Anotia

At a glance

Occurrence records16

Data sources5

Biological traits0

DNA specimens5

eDNA detections5

Sources5 archives

Databases and archives Anotia bonnetii's data was compiled from.

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anotia bonnetii has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.31%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

157Amostly conserved

166Cvariable

302Gmostly conserved

530Tvariable

TCTATACTTCATCTTTGGACTATGATCAGGACTTTTAGGATCAATAAGAAGAATTATTATTCGAATTGAATTAACACAACCAGGATCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anotia kirkaldyisame genus13.8%Lydda elongatasame family16.4%Aphelonema simplexsame order16.8%Scolops hesperiussame order17.6%Dictyophara europaeasame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor15

Museum / vouchered1

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 7≤1 km 2>10 km 5

14 georeferenced · 1 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
CUlocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Anotia bonnetii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 23.3–23.5

Seasonal swing summer↔winter25.6 °C

Max temp (day)27.6 °C 27.6–27.7

Min temp (night)19.6 °C 19.3–19.6

Precipitation109 mm/mo 98.3–109

Air humidity60.8 % 58.3–60.8

Moisture balance-49.9 mm/mo -68.2–-49.9

Vapour deficit1,137 Pa 1,137–1,194

Wind speed3.90 m/s 3.30–3.90

Cloud cover38.2 % 36.6–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)