Anostomoides atrianalis

Pellegrin, 1909 · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Anostomidae/Anostomoides

At a glance

Occurrence records13

Data sources6

Biological traits3

DNA specimens8

eDNA detections0

Sources6 archives

Databases and archives Anostomoides atrianalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF13 records

DNA & barcodingBOLD8 specimens

01Narrative

Anostomoides est un genre de poissons d'eau douce d'Amérique du Sud de la famille des Anostomidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability26.3

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anostomoides atrianalis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.24%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

24Gmostly conserved

201Gmostly conserved

216Amostly conserved

312Amostly conserved

372Amostly conserved

AAAGACATTGGCACCCTCTACCTGGTATTTGGTGCCTGAGCCGGAATAGTTGGAACAGCCCTTAGCCTCCTAATTCGAGCAGAGCTCAGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Laemolyta garmanisame family10.4%Leporinus microphthalmussame family10.9%Leporinus multimaculatussame family10.9%Laemolyta fernandezisame family10.9%Leporinus octofasciatussame family11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor1

Museum / vouchered12

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	3
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	2
FishBaselocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
University of Nebraskalocation not on record	1

5 institutions · 8 of 12 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)