Anostirus daimio

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Anostirus

At a glance

Occurrence records35

Data sources6

Biological traits0

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Anostirus daimio's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anostirus daimio is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1894 door Lewis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anostirus daimio has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P669 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

55Tmostly conserved

207Cmostly conserved

210Tmostly conserved

213Gmostly conserved

231Tmostly conserved

240Cmostly conserved

273Gvariable

276Cmostly conserved

283Tmostly conserved

285Amostly conserved

360Tmostly conserved

378Amostly conserved

402Cmostly conserved

426Tmostly conserved

438Gmostly conserved

450Tmostly conserved

456Tmostly conserved

462Amostly conserved

483Amostly conserved

513Avariable

534Amostly conserved

537Cmostly conserved

540Cmostly conserved

547Tmostly conserved

549Amostly conserved

570Tvariable

586Tmostly conserved

606Tmostly conserved

621Cmostly conserved

651Tmostly conserved

654Amostly conserved

ATTGGTACCTTATATTTCCTCTTTGGAGCATGGTCAGGAATATTAGGAACATCCTTAAGACTCCTTATTCGAGCTGAATTAGGAAATCCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes4

BINs2

Most divergent pair3.9%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anostirus castaneussame genus8.4%Anostirus purpureussame genus12.3%Pseudanostirus nebraskensissame family14.3%Calambus japonicussame family14.5%Pseudanostirus tigrinussame family14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type35 records

Wild obs. + sensor1

Museum / vouchered34

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤1 km 12≤10 km 4>10 km 1

17 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Iwate Prefectural Museumlocation not on record	14
Kushiro City Museumlocation not on record	5
RCMlocation not on record	5
Chiba, JP	3
Tomioka, JP	3
Sagamihara, JP	2
Yamaguchi-shi, JP	1
Cornell University Insect Collectionlocation not on record	1

8 institutions · 34 of 34 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Anostirus daimio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 19.2–19.2

Seasonal swing summer↔winter25.4 °C

Max temp (day)21.2 °C

Min temp (night)15.4 °C

Precipitation463 mm/mo

Air humidity65.7 %

Moisture balance325 mm/mo

Vapour deficit769 Pa

Wind speed2.50 m/s

Cloud cover50.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)