Anoplotrupes stercorosus

(Hartmann, 1791) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Geotrupidae/Anoplotrupes

At a glance

Occurrence records64 556

Data sources8

Biological traits0

DNA specimens75

eDNA detections6

Sources8 archives

Databases and archives Anoplotrupes stercorosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 556 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF64 556 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD75 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Anoplotrupes stercorosus, le Géotrupe des bois, Géotrupe forestier ou Bousier commun, est une espèce d'insectes de l'ordre des coléoptères, de la famille des Geotrupidae, de la sous-famille des Geotrupinae et du genre Anoplotrupes

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplotrupes stercorosus has left across the world's sequence archives.

At a glance

DNA specimens75

BINs2

Marker genes3

eDNA detections6

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 95 variable positions, in barcode order

1Amostly conserved

5Cmostly conserved

14Cmostly conserved

22Amostly conserved

28Gmostly conserved

31Amostly conserved

34Amostly conserved

40Amostly conserved

46Amostly conserved

49Tmostly conserved

59Tmostly conserved

70Amostly conserved

79Amostly conserved

85Amostly conserved

88Cmostly conserved

91Amostly conserved

100Amostly conserved

113Tmostly conserved

121Tmostly conserved

127Tmostly conserved

133Amostly conserved

139Amostly conserved

169Amostly conserved

173Amostly conserved

184Tmostly conserved

187Cmostly conserved

193Cmostly conserved

212Cmostly conserved

217Amostly conserved

220Tmostly conserved

223Amostly conserved

238Tmostly conserved

263Cmostly conserved

265Tmostly conserved

266Tmostly conserved

268Amostly conserved

271Cmostly conserved

274Cmostly conserved

283Tmostly conserved

302Cmostly conserved

307Tmostly conserved

312Gmostly conserved

313Amostly conserved

316Amostly conserved

328Amostly conserved

337Amostly conserved

340Cmostly conserved

347Tmostly conserved

349Amostly conserved

353Gmostly conserved

355Amostly conserved

367Tmostly conserved

376Tmostly conserved

379Amostly conserved

382Amostly conserved

401Cmostly conserved

403Tmostly conserved

406Cmostly conserved

412Amostly conserved

415Amostly conserved

421Cmostly conserved

424Tmostly conserved

433Tmostly conserved

436Amostly conserved

451Cmostly conserved

454Tmostly conserved

457Tmostly conserved

472Tmostly conserved

473Tmostly conserved

478Amostly conserved

490Tmostly conserved

493Amostly conserved

499Amostly conserved

526Amostly conserved

529Tmostly conserved

536Cmostly conserved

538Tmostly conserved

539Tmostly conserved

541Amostly conserved

553Tmostly conserved

557Cmostly conserved

565Tmostly conserved

574Tmostly conserved

580Amostly conserved

592Tmostly conserved

596Cmostly conserved

604Amostly conserved

619Gmostly conserved

622Amostly conserved

625Tmostly conserved

628Amostly conserved

637Tmostly conserved

641Cmostly conserved

643Tmostly conserved

646Tmostly conserved

AACTCTATATTTTCTATTTGGATCTTGGGCAGGAATAGTAGGAACATCTTTAAGAATTTTAATTCGAGCAGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes12

BINs2

Most divergent pair14.6%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Geotrupes stercorariussame family9.6%Geotrupes ibericussame family11.0%Geotrupes spinigersame family11.1%Trypocopris fulgidussame family11.7%Thorectes laevigatussame family11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anoplotrupes stercorosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–222n range20median20mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 206×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Wilson CJ, Angus RB (2004) A chromosome investigation of seven geotrupids and two aegialiine. Nouvelle Revue d'Entomologie 21: 157-170. ↗

2n 225×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Colomba M, Vitturi R, Volpe N, Lannino A, Zunino M (2004) Karyotype, banding and rDNA FISH in the scarab beetle Anoplotrupes stercorosus (Coleoptera Scarabaeoidea: Geotrupidae). Description and comparative analysis. Micron 35: 717-720. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type64 556 records

Wild obs. + sensor64 247

Museum / vouchered281

Cultivated / captive28

Range

Area of Occupancy AOO119 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 26 427≤1 km 10 314≤10 km 10 809>10 km 1 163

48 713 georeferenced · 15 534 without coordinates

Open the mapobservation + sensor64 247

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 103≤1 km 35≤10 km 78>10 km 4

220 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence281

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 28 records without

Open the mapnot free-living28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NMBU:MINAlocation not on record	64
IFR-DNFlocation not on record	26
South Kensington, GB	9
ZSMlocation not on record	8
University of Turinlocation not on record	4
Naturalis Biodiversity Centerlocation not on record	3
Fergusson College (Autonomous)location not on record	3
Copenhagen, DK	3
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Norwegian University of Life Sciences (NMBU)location not on record	2
Naturhistorisches Museum Wienlocation not on record	1
San Francisco, US	1

12 institutions · 126 of 281 vouchered records shown · 152 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Anoplotrupes stercorosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 8.70–15.4

Seasonal swing summer↔winter20.4 °C

Max temp (day)13.8 °C 12.3–19.6

Min temp (night)5.70 °C 5.00–10.4

Precipitation54.8 mm/mo 45.1–81.5

Air humidity61.5 % 59.1–62.8

Moisture balance-26.0 mm/mo -35.2–-22.1

Vapour deficit550 Pa 487–752

Wind speed3.90 m/s 2.70–4.60

Cloud cover42.0 % 38.2–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anoplotrupes stercorosus

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type64 556 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type64 556 records