Anoplotettix fuscovenosus

(Ferrari, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Anoplotettix

At a glance

Occurrence records94

Data sources6

Biological traits0

DNA specimens4

eDNA detections40

Sources6 archives

Databases and archives Anoplotettix fuscovenosus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 1 countries40 detections

DNA & barcodingBOLD4 specimens

01Narrative

Anoplotettix fuscovenosus is a species of leafhoppers belonging to the family Cicadellidae subfamily Deltocephalinae. A subspecies is Anoplotettix fuscovenosus bipuncta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplotettix fuscovenosus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections40

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACAATATATTTCCTATTTGGAATTTGATCAGGTATAGTGGGGATAATACTTAGAATGATTATCCGAATTGAACTAGCTCAACCTGGGAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplotettix eubeaticussame genus6.9%Maiestas horvathisame family15.5%Colladonus tahotussame family16.2%Colladonus clitellariussame family16.3%Texananus extremussame family16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor91

Museum / vouchered3

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 54≤1 km 4≤10 km 13>10 km 2

73 georeferenced · 18 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	1

1 institutions · 1 of 3 vouchered records shown · 2 without an institution code

09Environmental DNA40 detections

Where the DNA of Anoplotettix fuscovenosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map1 country0

Urban areaMediterranean forestDeciduous forestOlive orchard85Non coniferous evergreen forests

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–21.1

Seasonal swing summer↔winter17.2 °C

Max temp (day)21.2 °C 20.2–25.8

Min temp (night)11.6 °C 11.6–15.2

Precipitation58.7 mm/mo 40.1–58.7

Air humidity56.5 % 53.9–58.5

Moisture balance-79.1 mm/mo -122–-79.1

Vapour deficit839 Pa 804–1,155

Wind speed3.00 m/s 2.90–3.00

Cloud cover41.5 % 39.2–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)