Anoplognathus olivieri

(Schönherr & Dalman, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Anoplognathus

At a glance

Occurrence records1 787

Data sources5

Biological traits0

DNA specimens20

eDNA detections20

Sources5 archives

Databases and archives Anoplognathus olivieri's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 787 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 787 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD20 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplognathus olivieri has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections20

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

304Gvariable

430Gvariable

628Tmostly conserved

643Amostly conserved

TACACTTTATTTTCTGTTTGGCAGATGGGCTGGAATGGTAGGAACATCTCTTAGAATTTTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes6

BIN1

Most divergent pair0.76%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplognathus porosussame genus6.7%Anoplognathus pallidicollissame genus10.3%Chlorota batesisame family14.9%Macraspis hirtiventrissame family16.7%Chlorota panamensissame family17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 787 records

Wild obs. + sensor1 275

Museum / vouchered512

Range

Area of Occupancy AOO2 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 775≤1 km 143≤10 km 99>10 km 129

1 146 georeferenced · 129 without coordinates

Open the mapobservation + sensor1 275

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy1% within 1 km

≤100 m 2≤1 km 2≤10 km 287>10 km 8

299 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence512

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	215
DPIlocation not on record	85
Sydney, AU	79
QVMAGlocation not on record	68
Museums Victorialocation not on record	56
Natick, US	9

6 institutions · 512 of 512 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Anoplognathus olivieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 22.3–22.4

Seasonal swing summer↔winter8.60 °C

Max temp (day)23.8 °C 23.7–23.8

Min temp (night)20.9 °C 20.8–20.9

Precipitation110 mm/mo 109–110

Air humidity61.6 %

Vapour deficit1,033 Pa 1,031–1,033

Cloud cover27.4 % 27.4–27.7

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anoplognathus olivieri

At a glance

Sources5 archives

At a glance

Record type1 787 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 787 records