Anoplodactylus californicus

Hall, 1912 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Pycnogonida/Pantopoda/Phoxichilidiidae/Anoplodactylus

At a glance

Occurrence records111

Data sources8

Biological traits4

DNA specimens10

eDNA detections10

Sources8 archives

Databases and archives Anoplodactylus californicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

OBISOcean Biodiversity Information System24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS111 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anoplodactylus californicus is een zeespin uit de familie Phoxichilidiidae. De soort behoort tot het geslacht Anoplodactylus. Anoplodactylus californicus werd in 1912 voor het eerst wetenschappelijk beschreven door Hall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max40 m

Depth min0 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplodactylus californicus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes2

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

340Cvariable

AACTTTATATTTAATTTTTGGAATTTGATCAGGTATGATTGGAACTAGATTAAGATTATTAATTCGACTAGAATTAAGAAGACCTGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplodactylus massiliformissame genus14.3%Scopula acidaliasame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type111 records

Wild obs. + sensor6

Museum / vouchered93

Other12

Origin

Introduced10

Range

Area of Occupancy AOO212 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 157.3 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 12≤1 km 4

16 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	32
Paris, FR	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Universidad Austral de Chilelocation not on record	4
Los Angeles, US	3
Santa Barbara Museum of Natural Historylocation not on record	2
UMAGlocation not on record	1
Cantablocation not on record	1
CASlocation not on record	1

9 institutions · 55 of 93 vouchered records shown · 17 without an institution code

09Environmental DNA10 detections

Where the DNA of Anoplodactylus californicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 14.2–14.2

Seasonal swing summer↔winter10.1 °C

Max temp (day)18.0 °C

Min temp (night)10.1 °C

Precipitation220 mm/mo

Air humidity63.4 %

Moisture balance112 mm/mo

Vapour deficit593 Pa

Wind speed3.50 m/s

Cloud cover15.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)