Anoplocnemis curvipes

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Coreidae/Anoplocnemis

At a glance

Occurrence records402

Data sources6

Biological traits0

DNA specimens3

eDNA detections7

Sources6 archives

Databases and archives Anoplocnemis curvipes's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility402 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF402 records

Environmental DNA2 datasets · 2 countries7 detections

DNA & barcodingBOLD3 specimens

01Narrative

Anoplocnemis curvipes is a species of sap-sucking insect in the genus Anoplocnemis. They are native to sub-saharan Africa where they are considered a major pest of many types of agricultural plants such as trees and shrubs, including legumes. This has earned them the name leaf-wilter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplocnemis curvipes has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P678 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes2

BIN1

Most divergent pair1.8%

Where individuals differ — all 12 variable positions, in barcode order

245Tvariable

296Avariable

308Tvariable

357Cvariable

359Avariable

371Gvariable

506Gvariable

560Gvariable

605Tvariable

641Avariable

644Cvariable

674Cvariable

AAGATATTGGAACCCTTTATTTTATTTTCGGTATATGATCCGGAATAGTAGGATCCTCAATAAGTTGAATCATCCGAGTAGAATTAGGAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplocnemis dallasisame genus10.5%Acroelytrum muricatumsame family11.0%Mictis serinasame family12.6%Mictis profanasame family13.5%Elasmolomus pallenssame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_035509 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type402 records

Wild obs. + sensor344

Museum / vouchered58

Range

Area of Occupancy AOO1 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 151≤1 km 46≤10 km 18>10 km 23

238 georeferenced · 106 without coordinates

Open the mapobservation + sensor344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 58 records without

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	21
National Museums of Kenyalocation not on record	12
KwaZulu-Natal Museumlocation not on record	6
IITACAMlocation not on record	4
Bonn, DE	2
IRADCAMINSECTCOLlocation not on record	1
Durban Natural Science Museumlocation not on record	1

7 institutions · 47 of 58 vouchered records shown · 11 without an institution code

09Environmental DNA7 detections

Where the DNA of Anoplocnemis curvipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 20.1–25.0

Seasonal swing summer↔winter5.80 °C

Max temp (day)27.7 °C 25.7–30.5

Min temp (night)17.3 °C 14.6–20.1

Precipitation109 mm/mo 87.0–155

Air humidity58.9 % 57.8–61.5

Moisture balance-61.3 mm/mo -66.5–-27.0

Vapour deficit1,122 Pa 994–1,218

Wind speed2.20 m/s 1.80–3.50

Cloud cover27.7 % 19.9–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)