Anopheles vagus

Döntiz, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records1 411

Data sources7

Biological traits0

DNA specimens225

eDNA detections223

Sources7 archives

Databases and archives Anopheles vagus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 411 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI223 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics225 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 411 records

Environmental DNA1 datasets · 8 countries223 detections

DNA & barcodingBOLD225 specimens

01Narrative

Anopheles (Cellia) vagus is a species complex of zoophilic mosquito belonging to the genus Anopheles. It is found in India, Sri Lanka and Indonesia. It is a potential natural vector of malarial parasite Plasmodium falciparum, and Japanese encephalitis virus. It is highly susceptible to insecticide deltamethrin and resistant to DDT.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding225 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles vagus has left across the world's sequence archives.

At a glance

DNA specimens225

BINs4

Marker genes1

eDNA detections223

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus136 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

27Cvariable

36Tmostly conserved

66Avariable

69Tvariable

72Cmostly conserved

78Avariable

192Amostly conserved

193Cvariable

201Tvariable

204Avariable

207Tvariable

210Cmostly conserved

258Cvariable

303Avariable

330Cvariable

339Avariable

342Gvariable

345Gvariable

351Tvariable

360Gvariable

369Cvariable

387Avariable

420Avariable

450Cvariable

453Amostly conserved

495Tmostly conserved

552Avariable

564Amostly conserved

594Gvariable

603Tvariable

606Tmostly conserved

621Cvariable

633Cvariable

648Gvariable

ATTTTTGGAGCTTGAGCAGGAATAGTCGGAACATCTCTTAGAATTCTAATTCGAGCTGAACTAGGACATCCCGGAGCATTTATTGGGGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes34

BINs4

Most divergent pair4.9%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles vestitipennissame genus10.2%Anopheles oswaldoisame genus10.2%Anopheles braziliensissame genus10.4%Anopheles konderisame genus10.7%Anopheles introlatussame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 411 records

Wild obs. + sensor102

Museum / vouchered1 309

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 102 records without

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 21>10 km 69

90 georeferenced · 1 219 without coordinates

Open the institutions mapphysical evidence1 309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	662
South Kensington, GB	459
San Francisco, US	70
New Haven, US	20
University of Queensland Insect Collectionlocation not on record	2

5 institutions · 1 213 of 1 309 vouchered records shown · 93 without an institution code

09Environmental DNA223 detections

Where the DNA of Anopheles vagus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found223

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 223 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 24.8–28.0

Seasonal swing summer↔winter4.90 °C

Max temp (day)29.7 °C 28.2–30.9

Min temp (night)23.1 °C 20.8–24.7

Precipitation176 mm/mo 44.4–222

Air humidity64.2 % 57.1–67.6

Moisture balance21.0 mm/mo -95.2–88.5

Vapour deficit1,270 Pa 1,014–1,405

Wind speed2.80 m/s 2.10–5.60

Cloud cover40.0 % 24.1–73.5

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles vagus

At a glance

Sources7 archives

At a glance

Record type1 411 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 411 records