Anopheles plumbeus

Stephens, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records2 622

Data sources8

Biological traits2

DNA specimens736

eDNA detections724

Sources8 archives

Databases and archives Anopheles plumbeus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 622 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI724 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics736 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 622 records

Environmental DNA3 datasets · 14 countries724 detections

DNA & barcodingBOLD736 specimens

Genome at a glanceNCBI≈195 Mbp

01Narrative

Anopheles plumbeus ist eine Art der Malariamücken (Anopheles), zu der heute auch Anopheles nigripes, corsicanus und intermedius als Synonyme gestellt werden.Walter Reed Biosystematics Unit: Systematic Catalog of the Culicidae, Anopheles plumbeus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding736 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles plumbeus has left across the world's sequence archives.

At a glance

DNA specimens736

BINs1

Marker genes5

eDNA detections724

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus698 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TACATTATATTTTATTTTTGGAGCCTGAGCTGGGATAGTAGGTACATCATTAAGAATTTTAATTCGAGTAGAATTAGGACATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.02%

Haplotypes6

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles baileyisame genus10.9%Anopheles barbirostrissame genus11.4%Hydrotaea floccosasame order11.8%Anopheles vestitipennissame genus12.0%Hydrotaea pilitibiasame order12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S18S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_086773 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2cox1COX2ATP8ATP6COX3nad3nad5nad4ND4LND6CYTBND1large subunit ribosomal RNAsmall subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceNCBI

The complete instruction manual Anopheles plumbeus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈194 692 612 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Anopheles plumbeus0.19 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 622 records

Wild obs. + sensor2 418

Museum / vouchered204

Origin

Native2

Range

Area of Occupancy AOO4 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 644≤1 km 28≤10 km 173>10 km 3

848 georeferenced · 1 570 without coordinates

Open the mapobservation + sensor2 418

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 11≤1 km 15≤10 km 9>10 km 1

36 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence204

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ITGlocation not on record	46
Brussels, BE	21
RBINS-Scientific Heritagelocation not on record	18
South Kensington, GB	7
NCMGlocation not on record	4
University of Queensland Insect Collectionlocation not on record	1
CBDClocation not on record	1
San Francisco, US	1
Natural History Museum, Londonlocation not on record	1

9 institutions · 100 of 204 vouchered records shown · 102 without an institution code

09Environmental DNA724 detections

Where the DNA of Anopheles plumbeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found724

Studies independent surveys3

Countries14

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 724 detections have coordinates

Open the map14 countries0

Cattle farmUrban city farmMixed woodland areaMixed livestock farm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 9.40–22.2

Seasonal swing summer↔winter16.5 °C

Max temp (day)20.7 °C 12.9–26.1

Min temp (night)12.7 °C 5.80–17.4

Precipitation77.1 mm/mo 50.0–145

Air humidity60.9 % 55.7–64.2

Moisture balance-35.6 mm/mo -67.3–31.3

Vapour deficit758 Pa 463–1,154

Wind speed2.70 m/s 1.70–4.50

Cloud cover39.9 % 28.8–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles plumbeus

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 622 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 622 records