Anopheles nuneztovari

Gabaldón, 1940 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records701

Data sources6

Biological traits0

DNA specimens363

eDNA detections146

Sources6 archives

Databases and archives Anopheles nuneztovari's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility701 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI146 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics363 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF701 records

Environmental DNA1 datasets · 5 countries146 detections

DNA & barcodingBOLD363 specimens

01Narrative

Anopheles nuneztovari is a species of mosquito in the order Diptera native to South America. The species was named by its discoverer, Arnoldo Gabaldón, to honor the Venezuelan entomologist Manuel Núñez Tovar.Arnoldo Gabaldón. 1940. Estudios sobre anofelinos. Serie I. 1. Description de Anopheles (Nyssorhynchus) nunez-tovari n. sp. y consideraciones sobre una sub-division del grupo Nyssorhynchus (Diptera, Culicidae). Publicaciones de la División de Malariología, Ministerio de Sanidad y Asistencia Social, Caracas, Venezuela, 5:3-7.Harry M. Savage. 1986. Identification and location of the holotype and paratypes of Anopheles (Nyssorhynchus) nuneztovari Gabaldon (Diptera: Culicidae). Mosquito Systematics Vol. 18(3,4): 279-283; http://www.dtic.mil/dtic/tr/fulltext/u2/a510552.pdf, last accessed 7 Oct 2018.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding363 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles nuneztovari has left across the world's sequence archives.

At a glance

DNA specimens363

BINs1

Marker genes3

eDNA detections146

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus245 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

6Tmostly conserved

18Amostly conserved

39Amostly conserved

75Tmostly conserved

102Cvariable

132Tmostly conserved

177Gmostly conserved

180Amostly conserved

186Avariable

198Amostly conserved

213Amostly conserved

267Tmostly conserved

315Tmostly conserved

324Amostly conserved

336Tmostly conserved

339Cmostly conserved

369Amostly conserved

411Amostly conserved

432Tvariable

552Amostly conserved

624Amostly conserved

642Tmostly conserved

654Tmostly conserved

TTATATTTTATTTTTGGAGCCTGAGCTGGAATAGTAGGAACTTCATTAAGTATTCTTATTCGAGCTGAATTAGGTCACCCAGGAGCTTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 58 variants.

Diversity (π)0.99%

Haplotypes58

BIN1

Most divergent pair3.2%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles dunhamisame genus1.8%Anopheles konderisame genus4.6%Anopheles oswaldoisame genus4.7%Anopheles evansaesame genus5.0%Anopheles tadeisame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type701 records

Wild obs. + sensor10

Museum / vouchered691

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 7 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 691 records without

Open the institutions mapphysical evidence691

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	159
Institut Pasteur de la Guyanelocation not on record	137
Museu Paraense Emílio Goeldilocation not on record	73
Rapport Annuel - Institut Pasteur de la Guyanelocation not on record	38
Service Départemental de Désinfectionlocation not on record	17
Rapport sur le fontionnement technique - Institut Pasteur de la Guyanelocation not on record	12
IEPA/LACENlocation not on record	9
Institut Pasteur de Guyane et le Service de Santé des Arméeslocation not on record	8
Service de Santé des Arméeslocation not on record	6
Fundação Oswaldo Cruzlocation not on record	3
University of Queensland Insect Collectionlocation not on record	1

11 institutions · 463 of 691 vouchered records shown · 154 without an institution code

09Environmental DNA146 detections

Where the DNA of Anopheles nuneztovari was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found146

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 146 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 23.1–26.1

Seasonal swing summer↔winter1.20 °C

Max temp (day)29.6 °C 26.4–30.2

Min temp (night)22.3 °C 19.8–22.8

Precipitation201 mm/mo 152–827

Air humidity66.7 % 62.9–73.6

Moisture balance62.4 mm/mo

Vapour deficit1,001 Pa 806–1,188

Wind speed1.00 m/s 0.7–2.00

Cloud cover42.0 % 23.2–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)