Anopheles maculatus

Theobald, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records628

Data sources7

Biological traits0

DNA specimens218

eDNA detections189

Sources7 archives

Databases and archives Anopheles maculatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI189 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics218 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF628 records

Environmental DNA1 datasets · 6 countries189 detections

DNA & barcodingBOLD218 specimens

Genome at a glanceGoaT · NCBI≈463 Mbp

01Narrative

Anopheles maculatus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1901 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding218 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles maculatus has left across the world's sequence archives.

At a glance

DNA specimens218

BINs7

Marker genes13

eDNA detections189

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus190 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

2Cvariable

3Tvariable

5Cmostly conserved

6Amostly conserved

36Tmostly conserved

39Tmostly conserved

57Tmostly conserved

60Cmostly conserved

78Gmostly conserved

120Tmostly conserved

123Amostly conserved

137Gmostly conserved

138Amostly conserved

141Amostly conserved

150Tmostly conserved

159Tmostly conserved

177Amostly conserved

189Amostly conserved

192Tmostly conserved

228Avariable

240Cmostly conserved

241Tmostly conserved

244Tmostly conserved

270Cmostly conserved

282Cmostly conserved

291Gmostly conserved

294Amostly conserved

300Tmostly conserved

315Amostly conserved

321Tmostly conserved

327Cmostly conserved

330Gmostly conserved

354Cmostly conserved

357Tmostly conserved

372Amostly conserved

375Tmostly conserved

381Amostly conserved

390Gmostly conserved

432Amostly conserved

435Amostly conserved

442Tmostly conserved

465Avariable

507Amostly conserved

513Amostly conserved

519Amostly conserved

522Amostly conserved

546Cmostly conserved

561Amostly conserved

564Cmostly conserved

573Tmostly conserved

576Amostly conserved

579Gmostly conserved

582Amostly conserved

603Tmostly conserved

615Cmostly conserved

ACTTCATTAAGAATTCTTATTCGAGCTGAATTAGGTCATCCAGGAGCTTTTATTGGTGACGATCAAATTTATAATGTGATTGTTACTGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes32

BINs7

Most divergent pair8.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles rampaesame genus6.2%Anopheles sawadwongpornisame genus6.5%Anopheles marshalliisame genus8.2%Anopheles gibbinsisame genus8.8%Anopheles melassame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_028218 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anopheles maculatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈462 688 933 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anopheles maculatus0.46 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.1% BUSCO

08Occurrence & distribution

Record type628 records

Wild obs. + sensor61

Museum / vouchered567

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 61 records without

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 3≤10 km 8>10 km 36

47 georeferenced · 520 without coordinates

Open the institutions mapphysical evidence567

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	414
San Francisco, US	42
University of Queensland Insect Collectionlocation not on record	4
Museum of National History ISLAMABAD, PAKISTANlocation not on record	4
Wuzhou, CN	3
New Haven, US	2
QSBG/BMNHlocation not on record	2
CUlocation not on record	1
SUMClocation not on record	1

9 institutions · 473 of 567 vouchered records shown · 93 without an institution code

09Environmental DNA189 detections

Where the DNA of Anopheles maculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found189

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 189 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 23.4–27.0

Seasonal swing summer↔winter2.20 °C

Max temp (day)28.4 °C 26.5–29.7

Min temp (night)22.4 °C 19.8–25.1

Precipitation131 mm/mo 110–325

Air humidity66.5 % 63.3–72.2

Moisture balance-4.80 mm/mo -47.1–156

Vapour deficit1,129 Pa 798–1,278

Wind speed1.70 m/s 1.10–5.60

Cloud cover50.1 % 38.7–63.9

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)