Anopheles eiseni

Coquillett, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records676

Data sources5

Biological traits0

DNA specimens24

eDNA detections9

Sources5 archives

Databases and archives Anopheles eiseni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility676 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF676 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD24 specimens

01Narrative

Anopheles eiseni is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1902 door Coquillett.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles eiseni has left across the world's sequence archives.

At a glance

DNA specimens24

BINs3

Marker genes3

eDNA detections9

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 81 variable positions, in barcode order

13Tmostly conserved

34Amostly conserved

40Amostly conserved

43Avariable

49Tmostly conserved

50Tmostly conserved

58Tmostly conserved

61Amostly conserved

76Avariable

82Cvariable

85Amostly conserved

91Amostly conserved

94Tmostly conserved

100Amostly conserved

106Tmostly conserved

124Tmostly conserved

127Cvariable

133Amostly conserved

187Tmostly conserved

190Avariable

202Avariable

205Amostly conserved

212Tmostly conserved

217Avariable

220Tmostly conserved

235Cmostly conserved

238Tvariable

268Amostly conserved

271Tvariable

274Cvariable

277Amostly conserved

284Cvariable

286Avariable

287Tmostly conserved

319Tmostly conserved

322Gvariable

328Tmostly conserved

340Cmostly conserved

343Cvariable

352Tmostly conserved

355Tmostly conserved

364Cvariable

367Tmostly conserved

370Avariable

373Amostly conserved

376Avariable

391Avariable

400Tmostly conserved

406Tmostly conserved

412Avariable

415Amostly conserved

424Avariable

433Avariable

439Amostly conserved

451Tmostly conserved

454Amostly conserved

457Amostly conserved

472Chighly variable

478Tmostly conserved

484Tmostly conserved

485Cvariable

487Avariable

508Tmostly conserved

517Amostly conserved

544Amostly conserved

547Amostly conserved

553Tmostly conserved

562Avariable

568Avariable

589Tvariable

604Tmostly conserved

607Tmostly conserved

610Tmostly conserved

616Cmostly conserved

619Tmostly conserved

622Tmostly conserved

628Amostly conserved

634Tmostly conserved

637Amostly conserved

640Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTAGGAACTTCTTTAAGTATTTTAATTCGAGCAGAATTAGGTCACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.5%

Haplotypes8

BINs3

Most divergent pair8.5%

OtherS.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles vestitipennissame genus7.1%Anopheles barbirostrissame genus7.1%Anopheles meraukensissame genus7.3%Anopheles konderisame genus7.3%Anopheles evansaesame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type676 records

Wild obs. + sensor5

Museum / vouchered671

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 142≤1 km 14≤10 km 39

195 georeferenced · 476 without coordinates

Open the institutions mapphysical evidence671

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	381
Ciudad de México, MX	155
Institut Pasteur de la Guyanelocation not on record	31
The University of the West Indies, Trinidad and Tobagolocation not on record	26
San Francisco, US	17
Service Départemental de Désinfectionlocation not on record	16
EcoFoGlocation not on record	11
Fundação Oswaldo Cruzlocation not on record	6
New Haven, US	5
UMR Ecologie des Forets de Guyanelocation not on record	4
Champaign, US	3
Universidad de Antioquia (UdeA)location not on record	2
Chicago, US	2
Centro Regional de Investigación en Salud Pública, Instituto Nacional de Salud Públicalocation not on record	1
University of Queensland Insect Collectionlocation not on record	1
ORSTOM/IRDlocation not on record	1
San Nicolás de los Garza, MX	1
Service de Santé des Arméeslocation not on record	1

18 institutions · 664 of 671 vouchered records shown · 6 without an institution code

09Environmental DNA9 detections

Where the DNA of Anopheles eiseni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

Primary forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 20.8–25.1

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.2 °C 24.9–30.1

Min temp (night)18.9 °C 16.3–21.6

Precipitation273 mm/mo 131–634

Air humidity66.1 % 64.8–67.9

Moisture balance145 mm/mo -3.00–471

Vapour deficit989 Pa 824–1,110

Wind speed1.10 m/s 0.7–2.40

Cloud cover33.3 % 25.4–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)