Anopheles cruzii

Dyar & Knab, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records1 105

Data sources8

Biological traits0

DNA specimens156

eDNA detections145

Sources8 archives

Databases and archives Anopheles cruzii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI145 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics156 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 105 records

Environmental DNA1 datasets · 1 countries145 detections

DNA & barcodingBOLD156 specimens

Genome at a glanceGoaT · NCBI≈184 Mbp

01Narrative

Anopheles cruzii, is the species of mosquito that mainly located in southern coast of Brazil, is main vector of malaria, Plasmodium vivax.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding156 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles cruzii has left across the world's sequence archives.

At a glance

DNA specimens156

BINs3

Marker genes13

eDNA detections145

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus78 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

27Cvariable

51Cvariable

75Cmostly conserved

189Tmostly conserved

192Tvariable

285Gmostly conserved

291Gmostly conserved

333Cvariable

342Amostly conserved

384Gmostly conserved

435Gmostly conserved

459Cmostly conserved

477Avariable

486Amostly conserved

526Tmostly conserved

615Tvariable

GGAATAGTTGGAACTTCATTAAGAATCTTAGTACGAGCAGAATTAGGACACCCTGGAGCATTTATTGGAGATGACCAAATTTATAATGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 46 variants.

Diversity (π)1.2%

Haplotypes46

BINs3

Most divergent pair5.4%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles laneanussame genus4.0%Anopheles homunculussame genus6.6%Anopheles boliviensissame genus8.3%Anopheles lepidotussame genus9.0%Anopheles barberisame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS2COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_044647 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anopheles cruzii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈184 069 349 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Anopheles cruzii0.18 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.3% BUSCO

08Occurrence & distribution

Record type1 105 records

Museum / vouchered1 105

Range

Area of Occupancy AOO60 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 105 records without

Open the institutions mapphysical evidence1 105

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFPRlocation not on record	1 035
Fundação Oswaldo Cruzlocation not on record	19
Washington, US	5
PUC-RSlocation not on record	2

4 institutions · 1 061 of 1 105 vouchered records shown · 43 without an institution code

09Environmental DNA145 detections

Where the DNA of Anopheles cruzii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found145

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 145 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 19.7–22.0

Seasonal swing summer↔winter7.10 °C

Max temp (day)23.8 °C 23.8–25.1

Min temp (night)16.5 °C 15.4–19.6

Precipitation170 mm/mo 170–175

Air humidity67.7 % 66.3–68.0

Moisture balance38.0 mm/mo 35.3–65.0

Vapour deficit730 Pa 730–893

Wind speed2.70 m/s 1.70–3.10

Cloud cover42.3 % 36.2–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles cruzii

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 105 records

Range

Museum / Voucheredphysical evidence

Holding institutions1 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 105 records