Anopheles claviger

(Meigen, 1804) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records3 807

Data sources8

Biological traits2

DNA specimens169

eDNA detections219

Sources8 archives

Databases and archives Anopheles claviger's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 807 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI219 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics169 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 807 records

Environmental DNA4 datasets · 19 countries219 detections

DNA & barcodingBOLD169 specimens

Genome at a glanceGoaT · TreeOfSex2n = 6

01Narrative

Anopheles claviger is a mosquito species found in Palearctic realm covering Europe, North Africa, northern Arabian Peninsula, and northern Asia. It is responsible for transmitting malaria in some of these regions. The mosquito is made up of a species complex consisting of An. claviger sensu stricto and An. petragnani Del Vecchio. An. petragnani is found only in western Mediterranean region, and is reported to bite only animals, hence, it is not involved in human malaria. It was on An. claviger that Giovanni Battista Grassi established the fact that only the female mosquitoes are responsible for transmitting malarial parasite Plasmodium falciparum in humans. An. claviger was known for breeding abundantly in Åland. As a result, malaria was endemic in the islands for at least 150 years, with severe malaria outbreaks being recorded in the 17th century, and in 1853 and 1862.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding169 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles claviger has left across the world's sequence archives.

At a glance

DNA specimens169

BINs6

Marker genes4

eDNA detections219

Countries20

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus160 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

4Amostly conserved

25Amostly conserved

28Gmostly conserved

40Cmostly conserved

94Cmostly conserved

160Amostly conserved

212Tmostly conserved

217Gmostly conserved

220Cmostly conserved

232Amostly conserved

250Tmostly conserved

271Cmostly conserved

274Cmostly conserved

289Amostly conserved

328Gmostly conserved

337Amostly conserved

340Cmostly conserved

352Amostly conserved

355Gmostly conserved

367Cmostly conserved

373Gmostly conserved

376Amostly conserved

430Gvariable

433Gmostly conserved

472Tmostly conserved

475Amostly conserved

553Avariable

565Gmostly conserved

571Cmostly conserved

616Tmostly conserved

619Tmostly conserved

622Cvariable

625Amostly conserved

628Avariable

631Gvariable

634Cmostly conserved

643Amostly conserved

646Cmostly conserved

TACATTATATTTTATTTTTGGGGCATGGGCAGGAATAGTCGGAACTTCATTAAGAATTTTAATTCGAGCTGAATTAGGTCATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 61 variants.

Diversity (π)2.2%

Haplotypes61

BINs6

Most divergent pair15.2%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles petragnanisame genus6.8%Anopheles baileyisame genus8.8%Anopheles lindesayisame genus9.0%Anopheles marshalliisame genus9.3%Anopheles argyropussame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS218S-3P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anopheles claviger carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 64×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Kitzmiller, J. B. (1963). "Mosquito Cytogenetics: A Review of the Literature, 1953-62." Bulletin of the World Health Organization 29(3): 345. ↗

08Occurrence & distribution

Record type3 807 records

Wild obs. + sensor3 364

Museum / vouchered443

Range

Area of Occupancy AOO6 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 388≤1 km 49≤10 km 355>10 km 1

793 georeferenced · 2 571 without coordinates

Open the mapobservation + sensor3 364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 17≤1 km 37≤10 km 25>10 km 35

114 georeferenced · 329 without coordinates

Open the institutions mapphysical evidence443

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	81
BMNHlocation not on record	71
Brussels, BE	59
RBINS-Scientific Heritagelocation not on record	43
San Francisco, US	38
Tartu, EE	8
South Kensington, GB	6
ITGlocation not on record	5
Cambridge, US	4
University of Queensland Insect Collectionlocation not on record	3
CBDClocation not on record	3
Animal and Plant Health Agency, UKlocation not on record	2
NCMGlocation not on record	2
New Haven, US	1
VPlocation not on record	1
SPblocation not on record	1

16 institutions · 328 of 443 vouchered records shown · 111 without an institution code

09Environmental DNA219 detections

Where the DNA of Anopheles claviger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found219

Studies independent surveys4

Countries19

Verifiable raw sequence linked22

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 219 detections have coordinates

Open the map19 countries0

Family-run diary and arable farmGrazing areas on fenlandGrazing marshstreamMixed livestock farm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 9.30–21.2

Seasonal swing summer↔winter15.4 °C

Max temp (day)18.4 °C 12.3–26.9

Min temp (night)11.0 °C 5.10–15.2

Precipitation60.9 mm/mo 21.7–93.8

Air humidity61.5 % 56.8–64.4

Moisture balance-21.9 mm/mo -117–12.3

Vapour deficit629 Pa 441–1,091

Wind speed3.10 m/s 2.40–4.50

Cloud cover41.9 % 34.4–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 126 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles claviger

At a glance

Sources8 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 807 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 807 records