Anopheles balabacensis

Baisas, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records208

Data sources7

Biological traits0

DNA specimens133

eDNA detections137

Sources7 archives

Databases and archives Anopheles balabacensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility208 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI137 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics133 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF208 records

Environmental DNA1 datasets · 2 countries137 detections

DNA & barcodingBOLD133 specimens

01Narrative

Anopheles balabacensis is a species of mosquito in the Culicidae family. The scientific name of this species was first published in 1936 by Baisas.Harbach, Ralph (2013) Mosquito Taxonomic Inventory - Valid Species (Last updated May 5, 2013)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding133 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles balabacensis has left across the world's sequence archives.

At a glance

DNA specimens133

BINs2

Marker genes3

eDNA detections137

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P629 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

242Cmostly conserved

437Amostly conserved

CGGGAATAGTAGGAACTTCTTTAAGAATCTTAATTCGAGCTGAATTAGGACATCCAGGAGCTTTTATTGGAGATGACCAAATTTATAATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes12

BINs2

Most divergent pair0.79%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles cracenssame genus4.5%Anopheles dirussame genus4.9%Anopheles latenssame genus5.2%Anopheles baimaiisame genus5.6%Anopheles introlatussame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type208 records

Museum / vouchered208

Range

Area of Occupancy AOO120 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 12

13 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence208

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	47
San Francisco, US	13

2 institutions · 60 of 208 vouchered records shown · 145 without an institution code

09Environmental DNA137 detections

Where the DNA of Anopheles balabacensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found137

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 137 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 24.8–27.7

Seasonal swing summer↔winter1.80 °C

Max temp (day)29.2 °C 27.2–30.2

Min temp (night)24.8 °C 20.8–26.2

Precipitation181 mm/mo 122–259

Air humidity66.5 % 64.5–70.9

Moisture balance40.3 mm/mo

Vapour deficit1,193 Pa 956–1,334

Wind speed2.10 m/s

Cloud cover54.6 % 21.7–68.4

CHELSA 1981–2010, ~9 km grid, at location & month of 79 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)