Anomoia purmunda

(Harris, 1780) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Anomoia

At a glance

Occurrence records4 290

Data sources9

Biological traits2

DNA specimens31

eDNA detections30

Sources9 archives

Databases and archives Anomoia purmunda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 290 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 290 records

Environmental DNA2 datasets · 8 countries30 detections

DNA & barcodingBOLD31 specimens

Genome at a glanceGoaT · NCBI≈798 Mbp

01Narrative

Seitenansicht Video einer Weißdorn-Bohrfliege (2 min 40 s) Die Weißdorn-Bohrfliege (Anomoia purmunda) ist eine Fliege aus der Familie der Bohrfliegen (Tephritidae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomoia purmunda has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections30

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

58Cmostly conserved

79Cmostly conserved

100Tmostly conserved

268Amostly conserved

316Amostly conserved

373Amostly conserved

601Cmostly conserved

616Cmostly conserved

619Cmostly conserved

AACATTATATTTTATTTTTGGGGCTTGAGCAGGTATAGTAGGGACTTCTTTAAGTATCTTAATCCGAGCAGAATTAGGCCATCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes10

BIN1

Most divergent pair1.8%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hydrotaea floccosasame order11.0%Ensina sonchisame family12.0%Volucella pellucenssame order12.3%Hydrotaea militarissame order12.5%Hydrotaea borussicasame order12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anomoia purmunda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈798 257 654 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anomoia purmunda0.80 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.4% BUSCO

08Occurrence & distribution

Record type4 290 records

Wild obs. + sensor4 029

Museum / vouchered261

Range

Area of Occupancy AOO7 820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 1 260≤1 km 342≤10 km 2 033>10 km 46

3 681 georeferenced · 348 without coordinates

Open the mapobservation + sensor4 029

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 54≤1 km 60≤10 km 91>10 km 3

208 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence261

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	104
SLU Artdatabankenlocation not on record	24
Tilburg, NL	23
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	20
Natural History Museum Rotterdamlocation not on record	13
South Kensington, GB	11
University of Tokyo, Department of Zoologylocation not on record	8
Philadelphia, US	8
Gothenburg, SE	8
Stockholm, SE	7
Helsinki, FI	7
DFFW2016location not on record	5
DFFW2018location not on record	4
Bavarian State Collection of Zoologylocation not on record	4
NCMGlocation not on record	3
Natural History Museum, Londonlocation not on record	1

16 institutions · 250 of 261 vouchered records shown · 11 without an institution code

09Environmental DNA30 detections

Where the DNA of Anomoia purmunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys2

Countries8

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map8 countries0

1.1. Boreal Forest|1. Forest & Woodland14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 11.9–19.4

Seasonal swing summer↔winter17.9 °C

Max temp (day)20.7 °C 14.1–23.2

Min temp (night)13.0 °C 8.60–14.7

Precipitation68.0 mm/mo 53.8–89.0

Air humidity60.0 % 56.8–63.6

Moisture balance-39.7 mm/mo -69.7–8.50

Vapour deficit777 Pa 505–952

Wind speed3.20 m/s 2.10–4.70

Cloud cover45.1 % 37.4–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anomoia purmunda

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 290 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 290 records