Anomis planalis

Swinhoe, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anomis

At a glance

Occurrence records27

Data sources6

Biological traits0

DNA specimens53

eDNA detections0

Sources6 archives

Databases and archives Anomis planalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF27 records

DNA & barcodingBOLD53 specimens

01Narrative

Anomis planalis, the common cotton looper, is a moth of the family Erebidae. The species was first described by Charles Swinhoe in 1902. It is found in northern Australia.Common cotton looper at PaDil The wingspan is about 28 mm. Adult forewing span c. 40 mm for females and 45 mm for males. The forewings are light yellow brown with weak watermark patterns running longitudinally across the wings. The hindwings are plain light yellow brown. Larvae are a pest of various Malvaceae species, including Hibiscus cannabinus and Gossypium hirsutum, as well as okra, Abutilon species and tomato.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomis planalis has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.56%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

1Amostly conserved

76Gmostly conserved

514Avariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGTATATTAATTCGTGCTGAATTGGGTAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyphia arciferasame family6.4%Savara pallidapexsame family7.0%Caradrina morosasame order7.3%Arthisma amisasame family7.5%Thausgea lolosame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor3

Museum / vouchered24

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7>10 km 1

8 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	15
Tallinn, EE	1
ZSMlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

5 institutions · 19 of 24 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)