Anomis leona

Schaus, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anomis

At a glance

Occurrence records62

Data sources6

Biological traits0

DNA specimens19

eDNA detections36

Sources6 archives

Databases and archives Anomis leona's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF62 records

Environmental DNA2 datasets · 9 countries36 detections

DNA & barcodingBOLD19 specimens

01Narrative

Anomis leona is een vlinder uit de familie spinneruilen (Erebidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1893 door Schaus & Clements. De soort komt voor in tropisch Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomis leona has left across the world's sequence archives.

At a glance

DNA specimens19

BINs3

Marker genes1

eDNA detections36

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

5Tmostly conserved

31Amostly conserved

50Tmostly conserved

58Avariable

59Tmostly conserved

82Cmostly conserved

85Cmostly conserved

91Amostly conserved

94Avariable

118Tmostly conserved

127Cmostly conserved

133Cmostly conserved

187Tmostly conserved

202Amostly conserved

205Amostly conserved

208Amostly conserved

220Cmostly conserved

235Cmostly conserved

274Amostly conserved

277Tmostly conserved

286Cvariable

319Gmostly conserved

322Tmostly conserved

361Tmostly conserved

364Tmostly conserved

379Amostly conserved

385Cmostly conserved

386Tmostly conserved

388Amostly conserved

400Amostly conserved

418Tmostly conserved

421Amostly conserved

428Cmostly conserved

508Amostly conserved

514Tmostly conserved

520Tmostly conserved

536Tmostly conserved

541Tmostly conserved

547Amostly conserved

548Tvariable

550Amostly conserved

553Tmostly conserved

556Amostly conserved

578Tmostly conserved

581Cmostly conserved

601Cmostly conserved

610Cvariable

616Cmostly conserved

622Cmostly conserved

626Gmostly conserved

628Tmostly conserved

637Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTATATTAATTCGAGCAGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes10

BINs3

Most divergent pair6.1%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rusicada albitibiasame family5.9%Anomis albitibiasame genus6.5%Rusicada nigritarsissame family6.5%Gonitis involutasame family6.5%Anomis sabuliferasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor55

Museum / vouchered7

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 15≤1 km 4≤10 km 1

20 georeferenced · 35 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Museums of Kenyalocation not on record	3
Forest Insect Museum Ibadan (FIMI)location not on record	2
Durban Natural Science Museumlocation not on record	1

3 institutions · 6 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA36 detections

Where the DNA of Anomis leona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys2

Countries9

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map9 countries0

3. Shrubland | 3.6. Subtropical/Tropical Moi…Tropical rainforest1. Forest & WoodlandForest / savannah patchworkgarden and surroundings

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 17.4–26.6

Seasonal swing summer↔winter3.60 °C

Max temp (day)25.8 °C 21.4–31.9

Min temp (night)21.2 °C 13.2–24.5

Precipitation115 mm/mo 29.1–199

Air humidity68.1 % 61.3–70.8

Moisture balance-17.4 mm/mo -79.6–65.7

Vapour deficit953 Pa 634–1,290

Wind speed1.40 m/s 1.00–3.30

Cloud cover28.8 % 12.2–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)