Anomalurus derbianus

(Gray, 1842) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Anomaluridae/Anomalurus

At a glance

Occurrence records534

Data sources9

Biological traits20

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Anomalurus derbianus's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF534 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Lord Derby's scaly-tailed squirrel (Anomalurus derbianus) is an anomalurid rodent native to Africa. It was named after Edward Smith-Stanley, 13th Earl of Derby.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAmnioteDBEltonTraits

Size & morphology3

Body mass666 g

⚠ sources differ — PanTHERIA: 666 g · AmnioteDB: 770 g · EltonTraits: 650 g

Head body length357 mm

SVL35.69 cm

Life cycle & reproduction3

Litter size1

⚠ sources differ — PanTHERIA: 1 · AmnioteDB: 1.17

Litters per year2 /year

Neonate mass160 g

Diet & foraging6

Breadth1

Fruit40 %

Invertebrate10 %

Nectar10 %

Plant other40 %

Trophic levelherbivore

Habitat & environment2

Habitat breadth1

Terrestriality2.00

Physiology & chemistry2

Precipitation mean117 mm

Temperature mean230 decidegC

Other traits4

Activity cycle1.00

Foraging stratumAr

Home range0.04 km²

Population density50.43 /km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomalurus derbianus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACACTATACCTTTTATTCGGTGCCTGAGCTGGGATAGTAGGTACAGCCTTAAGCCTACTAATTCGAGCTGAATTAGGGCAACCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomalurus peliisame genus11.9%Peromyscus nudipessame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_038173 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type534 records

Wild obs. + sensor103

Museum / vouchered430

Other1

Origin

Native58

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 28≤1 km 20≤10 km 34>10 km 4

86 georeferenced · 17 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 15≤1 km 17≤10 km 20>10 km 13

65 georeferenced · 365 without coordinates

Open the institutions mapphysical evidence430

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Museum for Central Africalocation not on record	224
	51
Bonn, DE	35
Chicago, US	18
Geneva, CH	16
Paris, FR	15
Washington, US	15
Brussels, BE	9
Sevilla, ES	8
Los Angeles, US	7
RBINS-Scientific Heritagelocation not on record	7
Barcelona, ES	6
South Kensington, GB	6
Stockholm, SE	4
Cambridge, US	3
Ann Arbor, US	2
Lubbock, US	1
New Haven, US	1
Toronto, CA	1
Berkeley, US	1

20 institutions · 430 of 430 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Anomalurus derbianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)