Anomalops katoptron

(Bleeker, 1856) · species

image placeholder — illustration coming later

Animalia/Chordata/Beryciformes/Anomalopidae/Anomalops

At a glance

Occurrence records120

Data sources10

Biological traits7

DNA specimens16

eDNA detections6

Sources10 archives

Databases and archives Anomalops katoptron's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

OBISOcean Biodiversity Information System70 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS120 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD16 specimens

01Narrative

The splitfin flashlightfish or two-fin flashlightfish (Anomalops katoptron) is a species of beryciform fish in the family Anomalopidae. It is found in warm waters in the central and western Pacific Ocean near shallow reefs 200 - in depth. It can grow to a length of 35 cm TL. It is the only known member of its genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length35 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max400 m

Depth min2 m

Vulnerability25

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomalops katoptron has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes11

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.34%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 6 variable positions, in barcode order

199Amostly conserved

430Tmostly conserved

442Tmostly conserved

535Tvariable

631Tmostly conserved

652Gmostly conserved

CCTGTATCTCGTATTCGGTGCATGAGCCGGCATGGTCGGCACAGCCCTAAGCCTTCTCATCCGAGCTGAGCTTAGTCAACCTGGGGCACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hoplostethus atlanticussame order12.8%Hoplostethus melanopezasame order13.0%Hoplostethus gigassame order13.5%Hoplostethus mentosame order13.7%Aulotrachichthys novaezelandicussame order14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_008128 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type120 records

Wild obs. + sensor8

Museum / vouchered109

Other3

Origin

Native2

Range

Area of Occupancy AOO172 km²

Depth

0–200 m sunlit6

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 30 m · max 365.8 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 7 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 3≤10 km 13>10 km 12

30 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	14
CASlocation not on record	8
University of California San Diegolocation not on record	7
Washington, US	3
Paris, FR	2
Toronto, CA	2
Los Angeles, US	2
Cambridge, US	1
University of Alberta Museumslocation not on record	1
	1
Frankfurt am Main	1
Western Australian Museumlocation not on record	1
Chicago, US	1

13 institutions · 44 of 109 vouchered records shown · 4 without an institution code

09Environmental DNA6 detections

Where the DNA of Anomalops katoptron was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.4 °C 27.5–28.4

Seasonal swing summer↔winter2.70 °C

Max temp (day)30.5 °C 29.6–30.5

Min temp (night)26.5 °C 25.5–26.5

Precipitation20.3 mm/mo 12.4–20.3

Air humidity60.2 % 60.0–60.2

Vapour deficit1,534 Pa 1,465–1,534

Cloud cover24.8 % 24.8–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)