Anomalon cruentatum

(Geoffroy, 1785) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Anomalon

At a glance

Occurrence records425

Data sources7

Biological traits0

DNA specimens25

eDNA detections38

Sources7 archives

Databases and archives Anomalon cruentatum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility425 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF425 records

Environmental DNA4 datasets · 7 countries38 detections

DNA & barcodingBOLD25 specimens

01Narrative

Anomalon cruentatum is a species of parasitoid wasps belonging to the family Ichneumonidae.BiolibN.S. GADALLAH, R.S. AHMED, A.H. EL-HENEIDY & S.M. MAHMOUD Ichneumonidae from the Suez Canal region Egypt (Hymenoptera, Ichneumonoidea)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomalon cruentatum has left across the world's sequence archives.

At a glance

DNA specimens25

BINs5

Marker genes1

eDNA detections38

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

11Amostly conserved

16Tmostly conserved

19Amostly conserved

28Amostly conserved

35Amostly conserved

55Tmostly conserved

61Tmostly conserved

79Tmostly conserved

82Tmostly conserved

87Cmostly conserved

130Amostly conserved

151Tmostly conserved

160Avariable

166Cvariable

178Gvariable

199Tmostly conserved

202Tvariable

214Tmostly conserved

217Amostly conserved

232Cmostly conserved

235Cvariable

244Tmostly conserved

247Cvariable

268Cvariable

274Tmostly conserved

275Tmostly conserved

283Tmostly conserved

295Amostly conserved

313Tmostly conserved

325Tmostly conserved

328Amostly conserved

331Amostly conserved

337Tmostly conserved

340Tmostly conserved

343Tvariable

349Cmostly conserved

350Cmostly conserved

352Tmostly conserved

360Gvariable

361Tmostly conserved

370Tmostly conserved

382Tmostly conserved

386Gmostly conserved

397Tmostly conserved

400Tmostly conserved

409Amostly conserved

412Amostly conserved

418Amostly conserved

430Amostly conserved

439Cmostly conserved

445Cmostly conserved

457Tmostly conserved

475Tmostly conserved

476Gvariable

487Tmostly conserved

496Cmostly conserved

530Tmostly conserved

544Amostly conserved

547Tmostly conserved

550Amostly conserved

559Tmostly conserved

562Tmostly conserved

583Tmostly conserved

589Tmostly conserved

593Tmostly conserved

604Cmostly conserved

613Tmostly conserved

616Amostly conserved

622Tvariable

625Tmostly conserved

628Amostly conserved

631Tmostly conserved

638Cmostly conserved

640Tvariable

643Cvariable

652Cvariable

AATTTATTTTATATTTGGAATATGAGCAGGTATAATAGGTTCATCAATAAGAATTATTATTCGAATAGAATTAGGTAATCCTGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes4

BINs5

Most divergent pair10.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomalon kozlovisame genus12.0%Diadegma exrelatorsame family14.2%Diadegma armillatumsame family15.0%Syspasis lineatorsame family15.0%Diadegma hygrobiumsame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type425 records

Wild obs. + sensor248

Museum / vouchered177

Origin

Native125

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 91≤1 km 27≤10 km 72>10 km 3

193 georeferenced · 55 without coordinates

Open the mapobservation + sensor248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 13≤1 km 38≤10 km 96>10 km 13

160 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
I.I. Schmalhausen Institute of Zoologylocation not on record	125
MZLUlocation not on record	20
SLU Artdatabankenlocation not on record	15
Stockholm, SE	5
Gothenburg, SE	4
Eszterhazy Karoly University of Applied Scienceslocation not on record	3
NCMGlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
South Kensington, GB	1
UGRlocation not on record	1

10 institutions · 177 of 177 vouchered records shown

09Environmental DNA38 detections

Where the DNA of Anomalon cruentatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys4

Countries7

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map7 countries0

1. Forest & Woodland | 1.9. Subtropical/Trop…lit et ripisylve de l'Alisosparse mediterranean grassland vegetation wi…1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.5–20.3

Seasonal swing summer↔winter15.2 °C

Max temp (day)20.2 °C 19.2–24.7

Min temp (night)12.2 °C 10.9–15.8

Precipitation56.4 mm/mo 36.8–164

Air humidity61.1 % 54.2–69.8

Moisture balance-67.4 mm/mo -101–71.3

Vapour deficit754 Pa 541–1,074

Wind speed2.50 m/s 1.30–4.00

Cloud cover44.6 % 29.8–79.2

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)