Anomalodiscus squamosus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Venerida/Veneridae/Anomalodiscus

At a glance

Occurrence records546

Data sources8

Biological traits4

DNA specimens16

eDNA detections16

Sources8 archives

Databases and archives Anomalodiscus squamosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility355 records↗

OBISOcean Biodiversity Information System191 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS546 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Anomalodiscus squamosus is een tweekleppigensoort uit de familie Veneridae. De wetenschappelijke naam is gepubliceerd in 1758 door Linnaeus in de tiende editie van Systema naturae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Vulnerability10

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomalodiscus squamosus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

181Tmostly conserved

237Amostly conserved

291Amostly conserved

520Cmostly conserved

TTTTCAATTTGATCTGGTTTGATGGGAACTGCTTTTAGTGTAATTATGCGAATAGAGTTGGCTATGCCTGGAAAGATGTTGGATGATGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes3

BIN1

Most divergent pair0.31%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type546 records

Wild obs. + sensor286

Museum / vouchered257

Fossil2

Other1

Range

Area of Occupancy AOO972 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16.8 m · max 23.5 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 83≤1 km 32≤10 km 10>10 km 10

135 georeferenced · 151 without coordinates

Open the mapobservation + sensor286

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 3≤1 km 43≤10 km 56>10 km 26

128 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	29
Museums Victorialocation not on record	27
Sydney, AU	26
Santa Barbara Museum of Natural Historylocation not on record	25
Cambridge, US	20
Philadelphia, US	20
Natural History Museum Rotterdamlocation not on record	16
Chicago, US	7
Denver, US	3
QVMAGlocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Chongqing Museumlocation not on record	2
CASlocation not on record	1
UNICAMPlocation not on record	1

14 institutions · 182 of 257 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Anomalodiscus squamosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)