Anomala albopilosa

(Hope, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Anomala

At a glance

Occurrence records969

Data sources8

Biological traits0

DNA specimens81

eDNA detections11

Sources8 archives

Databases and archives Anomala albopilosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility969 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics81 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS21 compounds

Occurrence & distributionGBIF969 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD81 specimens

01Narrative

Anomala albopilosa, known by the common names green chafer, white-haired leaf chafer and sugarcane white grub, is a species of chafer beetle in the family Scarabaeidae. It was originally described in the genus Euchlora by Frederick William Hope in 1839. The beetle is native to the four major islands of Japan (Kyushu, Shikoku, Honshu and Hokkaido), the Ryukyu Islands, Korea, and Taiwan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition21 compounds

Compounds documented for Anomala albopilosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty alcohols2

Fatty aldehydes2

Stigmastane steroids1

Cycloartane triterpenoids1

Simple phenolic acids1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4S,5R)-2-[[(1S,2S,5R,7S,10R,12S,15R,16R,17S,18R,21R,22R,24S)-21,22-dihydroxy-1,6,6,15,17,20,20-heptamethyl-19,23-dioxaheptacyclo[13.10.0.02,12.05,10.010,12.016,24.018,22]pentacosan-7-yl]oxy]oxane-3,4,5-triol	present	NPASS
2-Nonen-1-ol	present	LOTUS
2-Nonenal	present	LOTUS
ACAYJUFAIJJELS-SDQBBNPISA-N	present	NPASS
beta-Sitosterol	present	NPASS
Buibuilactone	present	LOTUS
DTEPMSNVPQVQDW-UNRATHGWSA-N	present	NPASS
FRLGNHGNKSPOGU-SKRNURLDSA-N	present	NPASS
FRLGNHGNKSPOGU-ZXQUZLTDSA-N	present	NPASS
HOEACCWXJIUNFZ-PJDTTXJDSA-N	present	NPASS

05DNA & barcoding81 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomala albopilosa has left across the world's sequence archives.

At a glance

DNA specimens81

BINs3

Marker genes2

eDNA detections11

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P386 bp consensus72 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

15Cmostly conserved

21Gmostly conserved

30Amostly conserved

33Cmostly conserved

84Amostly conserved

132Amostly conserved

153Tmostly conserved

165Tmostly conserved

183Amostly conserved

186Cvariable

189Tvariable

222Cmostly conserved

234Gvariable

237Avariable

246Tmostly conserved

258Cmostly conserved

261Amostly conserved

267Tmostly conserved

268Cmostly conserved

276Amostly conserved

288Amostly conserved

289Tmostly conserved

291Amostly conserved

294Amostly conserved

297Tmostly conserved

304Cmostly conserved

307Tmostly conserved

312Tmostly conserved

316Tmostly conserved

318Amostly conserved

325Cvariable

330Tmostly conserved

333Tvariable

346Cmostly conserved

366Tmostly conserved

369Tmostly conserved

375Tmostly conserved

TTCCCCCGAATAAACAATATGAGTTTCTGACTCTTACCCCCTTCTCTTACTCTTCTTTTAATAAGAAGATTAGTAGAAAATGGAGCAGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes34

BINs3

Most divergent pair8.8%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type969 records

Wild obs. + sensor721

Museum / vouchered248

Range

Area of Occupancy AOO2 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 265≤1 km 53≤10 km 11>10 km 47

376 georeferenced · 345 without coordinates

Open the mapobservation + sensor721

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KCMNlocation not on record	87
Gyeryonsan Natural History Museumlocation not on record	54
NSMKlocation not on record	45
University of Central Floridalocation not on record	17
Toyota city nature sanctuarylocation not on record	10
Chiba, JP	5
Cornell University Insect Collectionlocation not on record	3
Nagatoro-machi, Chichibu-gun, JP	2
Tomioka, JP	2

9 institutions · 225 of 248 vouchered records shown · 22 without an institution code

09Environmental DNA11 detections

Where the DNA of Anomala albopilosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 14.0–24.0

Seasonal swing summer↔winter25.4 °C

Max temp (day)21.2 °C 16.6–26.1

Min temp (night)15.4 °C 9.40–20.4

Precipitation404 mm/mo 247–516

Air humidity65.7 % 62.5–68.7

Moisture balance325 mm/mo

Vapour deficit769 Pa 600–979

Wind speed2.50 m/s

Cloud cover50.0 % 40.6–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)