Anolis wellbornae

Ahl, 1940 · species

image placeholder — illustration coming later

Animalia/Chordata/Squamata/Dactyloidae/Anolis

At a glance

Occurrence records173

Data sources7

Biological traits3

DNA specimens11

eDNA detections10

Sources7 archives

Databases and archives Anolis wellbornae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Anolis wellbornae is a species of lizard in the family Dactyloidae. The species is found in Nicaragua, El Salvador, Honduras, and Guatemala."Anolis wellbornae' ". The Reptile Database. http://reptile-database.reptarium.cz/species?genus=Anolis&species=wellbornae

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDB

Size & morphology3

Body mass1.6 g

Body mass (male)1.6 g

SVL4.28 cm

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anolis wellbornae has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

1Tmostly conserved

29Gmostly conserved

63Amostly conserved

72Cmostly conserved

81Cmostly conserved

102Tmostly conserved

132Cmostly conserved

177Amostly conserved

189Tmostly conserved

198Gmostly conserved

231Cmostly conserved

261Gmostly conserved

354Tmostly conserved

414Tmostly conserved

450Tmostly conserved

456Tmostly conserved

504Tmostly conserved

521Cmostly conserved

549Gmostly conserved

573Amostly conserved

576Amostly conserved

577Cmostly conserved

582Amostly conserved

621Amostly conserved

636Amostly conserved

TTATACTTAATCTTTGGGGCCTGAGCTGGAATAGTTGGCACAGCACTAAGCCTTCTCATCCGAGCAGAACTCAGCCAACCCGGGGCCCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.77%

Haplotypes8

BINs2

Most divergent pair0.77%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anolis unilobatussame genus3.5%Anolis laeviventrissame genus14.8%Anolis poecilopussame genus15.7%Anolis macrophallussame genus16.0%Anolis humilissame genus16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor127

Museum / vouchered46

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 50≤1 km 34≤10 km 16>10 km 16

116 georeferenced · 11 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7

7 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	34
Ann Arbor, US	7
Universidad del Valle de Guatemalalocation not on record	3
Universidad Católica de Manizaleslocation not on record	2

4 institutions · 46 of 46 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Anolis wellbornae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)