Anolis roquet

(Bonnaterre, 1789) · species

image placeholder — illustration coming later

Animalia/Chordata/Squamata/Dactyloidae/Anolis

At a glance

Occurrence records1 881

Data sources7

Biological traits0

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Anolis roquet's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 881 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 881 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT2n = 34

01Narrative

Anolis roquet est une espèce de sauriens de la famille des Dactyloidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anolis roquet has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 63 variable positions, in barcode order

7Cmostly conserved

21Cmostly conserved

25Avariable

31Cmostly conserved

40Amostly conserved

46Avariable

47Tvariable

52Cvariable

73Amostly conserved

85Avariable

97Amostly conserved

106Amostly conserved

109Tmostly conserved

115Cmostly conserved

139Tmostly conserved

142Amostly conserved

145Amostly conserved

166Avariable

175Tmostly conserved

199Amostly conserved

211Cvariable

214Tmostly conserved

223Cmostly conserved

226Avariable

235Amostly conserved

247Cvariable

253Cmostly conserved

262Cmostly conserved

265Amostly conserved

284Tmostly conserved

298Cmostly conserved

307Amostly conserved

316Tmostly conserved

319Gvariable

322Tmostly conserved

325Tmostly conserved

334Cvariable

340Cmostly conserved

352Cvariable

358Amostly conserved

364Cmostly conserved

370Avariable

394Tmostly conserved

403Cmostly conserved

412Gvariable

413Gmostly conserved

454Cvariable

457Cvariable

466Amostly conserved

469Cmostly conserved

478Gmostly conserved

481Cmostly conserved

484Avariable

487Tmostly conserved

496Cmostly conserved

497Tmostly conserved

511Cmostly conserved

514Tmostly conserved

538Amostly conserved

541Cvariable

568Tmostly conserved

592Cmostly conserved

601Amostly conserved

TCTTTACCTAATCTTTGGTGCCTGAGCCGGCATAATTGGAACAGGATTAAGCCTTCTCATTCGAGCTGAACTAAGTCAACCAGGAGCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.8%

Haplotypes7

BINs3

Most divergent pair8.4%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anolis extremussame genus6.5%Anolis aeneussame genus9.3%Anolis trinitatissame genus13.1%Anolis richardiisame genus13.7%Anolis griseussame genus14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anolis roquet carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type1 881 records

Wild obs. + sensor778

Museum / vouchered1 103

Origin

Native11

Range

Area of Occupancy AOO900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 321≤1 km 118≤10 km 57>10 km 40

536 georeferenced · 242 without coordinates

Open the mapobservation + sensor778

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 257≤10 km 773>10 km 33

1 063 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence1 103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	1 032
Berkeley, US	25
Southeastern Louisiana University, Vertebrate Museumlocation not on record	18
Los Angeles, US	11
Ann Arbor, US	6
Washington, US	3
ASUlocation not on record	1

7 institutions · 1 096 of 1 103 vouchered records shown · 7 without an institution code

09Environmental DNA8 detections

Where the DNA of Anolis roquet was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 23.8–27.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.6–28.0

Min temp (night)23.9 °C 22.2–26.1

Precipitation282 mm/mo 237–314

Air humidity69.5 % 62.2–76.1

Moisture balance76.6 mm/mo 37.2–150

Vapour deficit986 Pa 713–1,341

Wind speed3.80 m/s 3.10–4.30

Cloud cover25.8 % 25.0–26.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anolis roquet

At a glance

Sources7 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 881 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 881 records