Anoectochilus sandvicensis

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Anoectochilus

At a glance

Occurrence records54

Data sources7

Biological traits20

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Anoectochilus sandvicensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF54 records

DNA & barcodingNCBIsequences

01Narrative

Anoectochilus sandvicensis, also called Hawaii jewel-orchid, is a species of plant in the family Orchidaceae. It is endemic to Hawaii.Kew World Checklist of Selected Plant Families It is threatened by habitat loss. It is found in the Haleakala National Park.University of Hawaii, Hynson Laboratory, Co-invasions of mycorrhizal fungi and their host plants, Island Biogeography of Fungi It grows in dense, dark, and continuously saturated forest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length max15 mm

Fruit length min10 mm

Leaf length max80 mm

Leaf length min40 mm

Leaf width max40 mm

Leaf width min20 mm

Plant height max0.5 m

Plant height min0.1 m

Life cycle & reproduction4

Dehiscencedehiscent

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoectochilus sandvicensis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSPP309974.1 ↗669 bp

ACGT

CATTGTCGAGACCCTAAAGAGGATTGGATGACTTTGGATAACACGTGAACAATTGGCGGCAATTGCTGTCTATAAACACCATCCATCTAT …

Anoectochilus sandvicensis internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor14

Museum / vouchered40

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 14

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤1 km 15≤10 km 11>10 km 2

28 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	21
Bronx, US	10
Honolulu, US	6
Madison, US	3

4 institutions · 40 of 40 vouchered records shown