Anoectochilus koshunensis

Hayata · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Anoectochilus

At a glance

Occurrence records27

Data sources11

Biological traits9

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Anoectochilus koshunensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Anoectochilus koshunensis is a species of plant in the family Orchidaceae native to Taiwan and to Nansei-shoto (Ryukyu Islands).Kew World Checklist of Selected Plant Families

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition16 compounds

Compounds documented for Anoectochilus koshunensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids $ Stigmastane steroids3

Stigmastane steroids2

Cholestane steroids $ Ergostane steroids1

Lupane triterpenoids1

Quinoline alkaloids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3aR,5aR,5bS,7aR,9R,11aR,11bS,13aS,13bS)-3a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-2,3,4,5,5a,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydro-1H-cyclopenta[a]chrysen-9-ol	present	NPASS
(3S,8R,9S,10R,13R,14R,17S)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R,5R)-6-methyl-5-propan-2-ylhept-6-en-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(4R)-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxolan-2-one	present	LOTUS
(6R,9S)-3-Oxo-alpha-ionol glucoside	present	LOTUS
3-Pyridinylmethylbeta-D-glucopyranoside	present	LOTUS
Anoectosterol	present	LOTUS
beta-Sitosterol	present	LOTUS
butyl (3R)-4-hydroxy-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutanoate	present	LOTUS
Campesterol	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoectochilus koshunensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKT334331.1 ↗718 bpChina

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCTAAAGAGGATTGGATGACTTTGGATAACACGTGAACATTTGACGGCGGTTGCTG …

Anoectochilus koshunensis voucher S. W. Chung 357 (TAIF) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type27 records

Wild obs. + sensor20

Museum / vouchered7

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤100 m 1≤10 km 1>10 km 15

17 georeferenced · 3 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	4
Taipei, TW	3

2 institutions · 7 of 7 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Anoectochilus koshunensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)