Anoeconeossa communis

Taylor, 1987 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphalaridae/Anoeconeossa

At a glance

Occurrence records11

Data sources6

Biological traits0

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Anoeconeossa communis's data was compiled from.

GBIFGlobal Biodiversity Information Facility11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF11 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoeconeossa communis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P395 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes2

BIN1

Most divergent pair1.0%

Where individuals differ — all 4 variable positions, in barcode order

147Tmostly conserved

168Amostly conserved

218Tmostly conserved

264Amostly conserved

AATCTAAGATTTTGACTACTAATTCCTTCTTTATTTTTACTTATCTTAAGAAGCTTAGTTGATCAAGGAGCTGGTACAGGTTGAACAGTT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type11 records

Wild obs. + sensor1

Museum / vouchered10

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	2
Sydney, AU	1
Western Australian Museumlocation not on record	1

3 institutions · 4 of 10 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Anoeconeossa communis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–15.1

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C 9.20–20.4

Min temp (night)1.40 °C 1.40–10.0

Precipitation130 mm/mo 54.9–130

Air humidity62.6 % 55.8–62.6

Moisture balance54.3 mm/mo -58.6–54.3

Vapour deficit357 Pa 357–840

Wind speed5.90 m/s 4.20–5.90

Cloud cover38.9 % 20.8–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)