Anoecia corni

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Anoecia

At a glance

Occurrence records1 112

Data sources6

Biological traits0

DNA specimens270

eDNA detections985

Sources6 archives

Databases and archives Anoecia corni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI985 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics270 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 112 records

Environmental DNA5 datasets · 16 countries985 detections

DNA & barcodingBOLD270 specimens

01Narrative

De kornoeljeluis is een halfvleugelig insect uit de familie van de Aphididae. De soort komt voor in Europa en Azië en is geïntroduceerd in Zuid-Afrika en Noord-Amerika. Het ei van de kornoeljeluis overwintert. Uit deze eitjes worden in het voorjaar een eerste generatie van vleugelloze vrouwtjes geboren met gereduceerde ogen en ingekorte antennes. De volgende generaties kunnen wel vliegen. De kornoeljeluis leeft afwisselend op kornoelje en wortels van grassen. In Oost-Azië en de gebieden waar de luis geïntroduceerd is, leeft de soort uitsluitend van grassen. Mieren bezoeken de luizen, met name de zwartbruine wegmier maar ook andere soorten Lasius. De gevleugelde imagines worden 1,9 tot 3 millimeter groot. Op de vleugels bevindt zich een opvallende zwarte vlek.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding270 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoecia corni has left across the world's sequence archives.

At a glance

DNA specimens270

BINs2

Marker genes1

eDNA detections985

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus262 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

356Cmostly conserved

581Gvariable

CATTATATTTCTTATTTGGTATATGATCAGGAATAATTGGATCATCACTTAGAATATTAATTCGACTTGAACTTAGACAAATCAATTCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes12

BINs2

Most divergent pair5.2%

EuropeOtherN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Shivaphis tilisuctasame family9.5%Eriosoma lanuginosumsame family10.2%Tuberculatus macrotuberculatussame family10.4%Cavariella konoisame family10.5%Shivaphis szelegiewiczisame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 112 records

Wild obs. + sensor968

Museum / vouchered144

Origin

Introduced4

Range

Area of Occupancy AOO2 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 333≤1 km 342≤10 km 252>10 km 2

929 georeferenced · 39 without coordinates

Open the mapobservation + sensor968

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 12≤1 km 10≤10 km 20>10 km 7

49 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	72
Champaign, US	28
Essig Museum of Entomologylocation not on record	26
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	6
UAclocation not on record	4
Tartu, EE	2
East Lansing, US	2
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1

9 institutions · 142 of 144 vouchered records shown · 2 without an institution code

09Environmental DNA985 detections

Where the DNA of Anoecia corni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found985

Studies independent surveys5

Countries16

Verifiable raw sequence linked561

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 985 detections have coordinates

Open the map16 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…3. Shrubland|3.8. Shrubland - Mediterranean-…1.1. Boreal Forest|1. Forest & Woodland1. Forest & Woodland | 1.4. Temperate ForestUrbanForest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 11.1–17.0

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.0 °C 14.4–20.8

Min temp (night)11.1 °C 8.00–13.5

Precipitation69.0 mm/mo 54.7–103

Air humidity62.3 % 60.0–64.6

Moisture balance-5.70 mm/mo -60.7–38.6

Vapour deficit630 Pa 467–760

Wind speed3.30 m/s 2.20–4.70

Cloud cover45.6 % 38.4–57.2

CHELSA 1981–2010, ~9 km grid, at location & month of 964 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anoecia corni

At a glance

Sources6 archives

At a glance

Record type1 112 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 112 records