Anodonta oregonensis

I.Lea, 1838 · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Anodonta

At a glance

Occurrence records320

Data sources6

Biological traits2

DNA specimens69

eDNA detections65

Sources6 archives

Databases and archives Anodonta oregonensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF320 records

Environmental DNA1 datasets · 1 countries65 detections

DNA & barcodingBOLD69 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anodonta oregonensis has left across the world's sequence archives.

At a glance

DNA specimens69

BINs3

Marker genes1

eDNA detections65

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 60 variable positions, in barcode order

1Tmostly conserved

2Cmostly conserved

4Gmostly conserved

5Gmostly conserved

6Tmostly conserved

7Tmostly conserved

9Amostly conserved

10Amostly conserved

11Tmostly conserved

12Tmostly conserved

13Gmostly conserved

14Gmostly conserved

15Gmostly conserved

16Tmostly conserved

17Tmostly conserved

18Amostly conserved

19Gmostly conserved

20Cmostly conserved

21Tmostly conserved

22Tmostly conserved

23Tmostly conserved

25Amostly conserved

26Gmostly conserved

27Gmostly conserved

28Cmostly conserved

30Tmostly conserved

31Tmostly conserved

33Gmostly conserved

34Amostly conserved

35Tmostly conserved

36Tmostly conserved

37Cmostly conserved

38Gmostly conserved

39Amostly conserved

41Cmostly conserved

42Tmostly conserved

43Gmostly conserved

44Amostly conserved

46Tmostly conserved

47Tmostly conserved

48Gmostly conserved

49Gmostly conserved

50Gmostly conserved

51Tmostly conserved

53Amostly conserved

55Cmostly conserved

56Cmostly conserved

58Gmostly conserved

60Amostly conserved

61Amostly conserved

62Gmostly conserved

66Gmostly conserved

67Tmostly conserved

68Tmostly conserved

69Amostly conserved

71Gmostly conserved

72Gmostly conserved

228Gvariable

447Amostly conserved

550Tvariable

TCTGGTTTAATTGGGTTAGCTTTGAGGCTTTTGATTCGAGCTGAGTTGGGTCAACCAGGAAGGTTGTTAGGGGATGATCAATTGTACAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes16

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudanodonta complanatasame family9.9%Lasmigona decoratasame family10.9%Pseudodontoideus subvexussame family11.1%Lasmigona subviridissame family11.3%Lanceolaria eucylindricasame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type320 records

Wild obs. + sensor80

Museum / vouchered240

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 43≤1 km 13≤10 km 3>10 km 4

63 georeferenced · 17 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤1 km 23≤10 km 9>10 km 17

49 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence240

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	45
Washington, US	40
Philadelphia, US	27
Cambridge, US	21
Victoria, CA	21
Chicago, US	8
North Carolina Museum of Natural Scienceslocation not on record	8
Los Angeles, US	6
Delaware Museum of Nature and Sciencelocation not on record	6
Champaign, US	6
Chongqing Museumlocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Barcelona, ES	4
Edmonton, CA	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Frankfurt am Main	2
The Ohio State University Museum of Biological Diversitylocation not on record	1
Alabama Museum of Natural Historylocation not on record	1
CASlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
Denver, US	1
Natural History Museum Rotterdamlocation not on record	1
Toronto, CA	1

24 institutions · 220 of 240 vouchered records shown · 20 without an institution code

09Environmental DNA65 detections

Where the DNA of Anodonta oregonensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 5.10–19.3

Seasonal swing summer↔winter15.3 °C

Max temp (day)17.9 °C 6.80–25.8

Min temp (night)6.90 °C 2.80–13.0

Precipitation75.9 mm/mo 36.1–183

Air humidity60.0 % 49.6–64.6

Moisture balance-43.4 mm/mo -86.5–156

Vapour deficit557 Pa 311–1,120

Wind speed2.10 m/s 1.50–3.60

Cloud cover38.1 % 31.8–52.4

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)