Anodonta nuttalliana

I.Lea, 1838 · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Unionida/Unionidae/Anodonta

At a glance

Occurrence records419

Data sources6

Biological traits2

DNA specimens159

eDNA detections190

Sources6 archives

Databases and archives Anodonta nuttalliana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI190 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics159 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF419 records

Environmental DNA1 datasets · 3 countries190 detections

DNA & barcodingBOLD159 specimens

01Narrative

The winged floater (Anodonta nuttalliana) is a species of freshwater mussel, an aquatic bivalve mollusk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding159 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anodonta nuttalliana has left across the world's sequence archives.

At a glance

DNA specimens159

BINs2

Marker genes1

eDNA detections190

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus150 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 78 variable positions, in barcode order

1Tmostly conserved

2Cmostly conserved

3Tmostly conserved

4Gmostly conserved

5Gmostly conserved

6Amostly conserved

7Tmostly conserved

9Gmostly conserved

10Amostly conserved

11Tmostly conserved

12Tmostly conserved

13Gmostly conserved

14Gmostly conserved

16Tvariable

17Tmostly conserved

18Gmostly conserved

19Gmostly conserved

20Cmostly conserved

21Tmostly conserved

22Tmostly conserved

23Tmostly conserved

24Amostly conserved

25Amostly conserved

26Gmostly conserved

28Cmostly conserved

30Gmostly conserved

31Tmostly conserved

33Amostly conserved

34Amostly conserved

35Tmostly conserved

36Tmostly conserved

37Cmostly conserved

38Gmostly conserved

39Amostly conserved

41Cmostly conserved

42Tmostly conserved

43Gmostly conserved

44Amostly conserved

46Tmostly conserved

47Tmostly conserved

48Gmostly conserved

49Gmostly conserved

50Gmostly conserved

51Tvariable

53Amostly conserved

54Amostly conserved

55Cmostly conserved

56Cmostly conserved

57Tmostly conserved

58Gmostly conserved

60Amostly conserved

61Amostly conserved

62Gmostly conserved

66Amostly conserved

67Tmostly conserved

68Tmostly conserved

69Gmostly conserved

71Gmostly conserved

72Amostly conserved

114Cmostly conserved

159Cmostly conserved

174Tmostly conserved

180Gmostly conserved

228Gmostly conserved

243Gmostly conserved

261Amostly conserved

267Cmostly conserved

333Tmostly conserved

342Tmostly conserved

369Tmostly conserved

402Gmostly conserved

474Amostly conserved

492Cmostly conserved

495Gvariable

504Gmostly conserved

510Amostly conserved

525Gvariable

573Tvariable

TCTGGATTGATTGGGTTGGCTTTAAGGCTGTTAATTCGAGCTGAGTTGGGTCAACCTGGAAGATTATTGGGAGATGATCAGTTATACAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 42 variants.

Diversity (π)3.7%

Haplotypes42

BIN1

Most divergent pair3.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anodonta impurasame genus6.1%Alasmidonta marginatasame family10.5%Pseudanodonta complanatasame family10.6%Alasmidonta ravenelianasame family11.3%Anodonta anatinasame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_057111 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX3ATP6ATP8ND4LND4ND6ND1ND5CYTBND2ND3COX216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type419 records

Wild obs. + sensor111

Museum / vouchered308

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 65≤1 km 9≤10 km 1>10 km 13

88 georeferenced · 23 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 8≤10 km 12>10 km 12

32 georeferenced · 276 without coordinates

Open the institutions mapphysical evidence308

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	98
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	27
Ann Arbor, US	22
Victoria, CA	16
Philadelphia, US	15
The Ohio State University Museum of Biological Diversitylocation not on record	13
Los Angeles, US	12
Chicago, US	12
Delaware Museum of Nature and Sciencelocation not on record	11
CASlocation not on record	7
Chicago, US	4
North Carolina Museum of Natural Scienceslocation not on record	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
Champaign, US	3
Frankfurt am Main	3
Toronto, CA	2
Cambridge, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Barcelona, ES	1
Santa Barbara Museum of Natural Historylocation not on record	1
Paleontological Research Institutionlocation not on record	1

21 institutions · 257 of 308 vouchered records shown · 51 without an institution code

09Environmental DNA190 detections

Where the DNA of Anodonta nuttalliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found190

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 190 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 12.5–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C 18.4–22.0

Min temp (night)9.00 °C 8.20–9.20

Precipitation34.7 mm/mo 34.7–90.0

Air humidity50.9 % 50.9–57.5

Moisture balance-93.3 mm/mo -93.3–-24.8

Vapour deficit884 Pa 721–884

Wind speed4.10 m/s 3.50–5.80

Cloud cover25.5 % 25.5–37.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)