Annona squamosa
speciesAt a glance
Occurrence records12 333
Data sources16
Biological traits126
DNA specimens24
eDNA detections14
Sources16 archives
Databases and archives Annona squamosa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 333 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources126 traits
Chemical compositionFooDB · LOTUS · NPASS6 054 compounds
Occurrence & distributionGBIF12 333 records
Environmental DNA1 datasets · 2 countries14 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB · GoaT · NCBI1.2 Gbp
01Narrative
L'attier ou pommier cannelle est une espèce de plantes à fleurs de la famille des Annonaceae et du genre Annona. C'est un arbuste fruitier originaire d'Amérique tropicale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology23
Fruit length75 mm
Fruit width75 mm
Inflorescence length max1 cm
Inflorescence length min800 cm
Leaf length120 mm
Leaf length max175 mm
Leaf length min60 mm
Leaf width42.5 mm
Leaf width max75 mm
Leaf width min20 mm
Petiole length1.5 cm
Plant height5.37 m
⚠ sources differ — GIFT: 5.37 m · AusTraits: 6 m · USDA: 6.1 m · TRY: 6.56 m
Plant height max5 m
Plant height min3 m
Seed length12.5 mm
Seed length max16 mm
Seed length min14 mm
Seed mass243 mg
⚠ sources differ — TRY: 243 mg · GIFT: 292 mg
Seed mass max333 mg
Seed mass min250 mg
Seed width8 mm
Seed width max7 mm
Seed width min6 mm
Life cycle & reproduction24
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal typeanimal
Flower colourgreen
⚠ sources differ — GIFT: green · USDA: Yellow
Flower conspicuousYes
Flowering timeyynnnnnnyyyy
Fruit seed period beginFall
Fruit seed period endFall
Life formshrub or tree
Life spanperennial
Lifeform raunkiaer detailedphanerophyte
Lifespan categoryShort
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityYes
Seedling vigorMedium
Diet & foraging1
Parasiteindependent
Habitat & environment33
Active growth periodSummer and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatewet tropical
Climberself-supporting
Elevation max1 300 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourgreen
Fruit fleshinessfleshy
Fruit typesyncarp
Growth formtree
Growth form USDASingle Crown
Habitat GIFTforest
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionYes
Leaf shapeelliptical lanceolate narrowly_elliptical oblong obovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min24 in
Shape and orientationRounded
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry22
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Frost free days min365 days
Leaf C:N ratio13.46 g/g
Leaf c422 mg/g
Leaf n25.8 mg/g
Leaf p1.7 mg/g
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max98 in
Precipitation min32 in
Salinity toleranceLow
Shade toleranceHigh
Specific leaf area (SLA)18.71 mm²/mg
Temperature min27 °F
Wood density601 mg/cm³
Uses & economy15
Berry nut seed productYes
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
ToxicitySlight
Veneer productNo
Other traits8
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr9.14 m
Planting density max640 per acre
Planting density min320 per acre
Seeds per fruit11-100
03Chemical composition6 054 compounds
Compounds documented for Annona squamosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Acetogenins203
Aminoacids71
Glycerophospholipids57
Aporphine alkaloids $ Isoquinoline alkaloids50
Aporphine alkaloids32
Documented compounds6 054 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sucrose | 30,895 mg/100g | FooDB | |
| beta-D-Glucopyranose | 17,270 mg/100g | FooDB | |
| Nitrogen | 3,600 mg/100g | FooDB | |
| Calcium | 2,120 mg/100g | FooDB | |
| Potassium | 774.5 mg/100g | FooDB | |
| epsilon-Polylysine | 130.25 mg/100g | FooDB | |
| L-Ascorbic acid | 97 mg/100g | FooDB | |
| Phosphorus | 93 mg/100g | FooDB |
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona squamosa has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes4
GenBank sequences10
eDNA detections14
Countries4
The DNA barcodea real sequence read deposited for this species
AAATGTTTTTTTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGC …
Annona squamosa ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL9★rbcLatrnH-psbA
plant barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Annona squamosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 173 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Annona squamosa1.17 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–182n range14median14mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1410×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Datta, P. C. & B. De. 1990. Karyology of some Indian Annonaceae. Cytologia 55: 187–196.
CCDB · book-indian_vol1 — Kumar, L.S.S. & Ranadive, K. 1941 ; Asana, J.J. & Adatia, R.D. 1945; Simmonds, N.W. 1954; Pawar, M.S. et at. 1956; Thakur, D.R. & Singh R.N. 1969
CCDB · book-fedorov — Kumar L. S., Ranadive 1941
CCDB · book-fedorov — Asana, Adatia 1945
CCDB · book-fedorov — Simmonds 1954, Pawar et al. 1956
CCDB · book-atlas-flowering-plants — Kumar & R. 1941
CCDB · book-atlas-flowering-plants — Asana & A. 1945
CCDB · kew — Ohri D, Kumar A. 1986. Nuclear DNA amounts in some tropical hardwoods. Caryologia 39: 303-307.
CCDB · Cave1956 — Pawar ,Borga. ,& Kulk.
2n 162×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Bowden, W.M. 1945a, 1948
CCDB · book-fedorov — Bowden 1945a, 1948
2n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.
n 142×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Gill, B. S., V. K. Singhal, Y. S. Bedi & S. S. Bir. 1990. Cytological evolution in the woody taxa of Pachmarhi Hills. J. Cytol. Genet. 25: 308–320.
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & V. K. Singhal. 1981. In Chromosome number reports LXXI. Taxon 30: 513–514.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type12 333 records
Wild obs. + sensor10 950
Museum / vouchered1 325
Cultivated / captive43
Other15
Origin
Native5
Introduced8
Range
Area of Occupancy AOO13 692 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 1 314≤1 km 255≤10 km 324>10 km 103
1 996 georeferenced · 8 954 without coordinates
Open the mapobservation + sensor10 950
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy89% within 1 km
≤100 m 424≤1 km 40≤10 km 45>10 km 11
520 georeferenced · 805 without coordinates
Open the institutions mapphysical evidence1 325
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 42 without coordinates
Open the mapnot free-living43
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions93 of 198 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 142 |
| Mexico City, MX | 107 |
| Mérida, MX | 54 |
| Saint Louis, US | 54 |
| Bronx, US | 41 |
| Chapingo, MX | 40 |
| Brisbane, AU | 31 |
| Beijing, CN | 27 |
| Smithfield, AU | 24 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 23 |
| Kunming, CN | 23 |
| Laboratorio de Ictiologialocation not on record | 20 |
| Tapachula, MX | 20 |
| Mexico City, MX | 18 |
| Baroda, IN | 18 |
| Guangzhou, CN | 16 |
| University of Stellenboschlocation not on record | 15 |
| Guilin, CN | 14 |
| Mérida, MX | 12 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| UNIVASFlocation not on record | 9 |
| Austin, US | 9 |
| Salvador, BR | 9 |
| Tampa, US | 9 |
| Southwest Forestry Collegelocation not on record | 9 |
| Masindi, UG | 9 |
| Kew, GB | 8 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| St. Augustine, TT | 7 |
| UEMAlocation not on record | 7 |
| Chaguaramas, TT | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| UFBAlocation not on record | 7 |
| San Francisco de Campeche, MX | 7 |
| South Kensington, GB | 6 |
| Taipei, TW | 6 |
| UNEMATlocation not on record | 6 |
| TAIElocation not on record | 6 |
| Pondicherry, IN | 6 |
| Autlán de Navarro, MX | 6 |
| Departamento de Sistematica e Ecologialocation not on record | 6 |
| Leiden University Medical Centerlocation not on record | 5 |
| LDlocation not on record | 5 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 5 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 5 |
| Auckland, NZ | 5 |
| Forest Herbarium Ibadan (FHI)location not on record | 5 |
| Paris, FR | 5 |
| Palmerston, AU | 5 |
| Chicago, US | 5 |
| Guatemala, GT | 4 |
| Stockholm, SE | 4 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 4 |
| Universidade Federal do Vale do São Franciscolocation not on record | 4 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 4 |
| UNESP-FCAlocation not on record | 4 |
| UFRPElocation not on record | 4 |
| Universidade Federal de Sergipe (UFS)location not on record | 4 |
| UFPElocation not on record | 4 |
| Fortaleza, BR | 4 |
| MEXUlocation not on record | 4 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 4 |
| WAGlocation not on record | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| UNICAMPlocation not on record | 3 |
| Porto Alegre, BR | 3 |
| Universidad de Antioquia (UdeA)location not on record | 3 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 3 |
| Université de Bordeauxlocation not on record | 3 |
| Riverside, US | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Honolulu, US | 3 |
| Ilhéus, BR | 3 |
| Universidade Federal do Maranhãolocation not on record | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| León, NI | 3 |
| Nanjing, CN | 3 |
| Mexico City, MX | 3 |
| Miami, US | 3 |
| Philadelphia, US | 3 |
| Instituto do Meio Ambientelocation not on record | 3 |
| MAlocation not on record | 3 |
| Universidade Federal de Juiz de Foralocation not on record | 3 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| Ciudad de México, MX | 3 |
| Teresina, BR | 3 |
| Canberra, AU | 3 |
| UEPAlocation not on record | 3 |
| BISHlocation not on record | 3 |
| Berlin, DE | 2 |
| San José, CR | 2 |
| UFVJMlocation not on record | 2 |
| URCAlocation not on record | 2 |
| Lake Charles, US | 2 |
| Mount Annan, AU | 2 |
| Clocation not on record | 2 |
| Haramaya Universitylocation not on record | 2 |
| Shanghai, CN | 2 |
| Addis Ababa, ET | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Uppsala, SE | 2 |
| Kensington, AU | 2 |
| CNF-UFHBlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| JBRJlocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Xiamen, CN | 2 |
| Feira de Santana, BR | 2 |
| USP-IBlocation not on record | 2 |
| San Diego, US | 2 |
| UFMSlocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| Yunnan Universitylocation not on record | 1 |
| Fort Worth, US | 1 |
| INMAlocation not on record | 1 |
| Nishihara, JP | 1 |
| Universidad Surcolombiana (USCO)location not on record | 1 |
| MeiseBGlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Criciúma, BR | 1 |
| Frankfurt am Main | 1 |
| UFPRlocation not on record | 1 |
| IFAN Ch. A. Dioplocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| Aarhus, DK | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Universidade de Passo Fundolocation not on record | 1 |
| Wlocation not on record | 1 |
| Christchurch, NZ | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Wayland Universitylocation not on record | 1 |
| Plocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| HNBlocation not on record | 1 |
| Yangling, CN | 1 |
| IANIGLAlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Lanzhou, CN | 1 |
| HUAlocation not on record | 1 |
| San Angelo, US | 1 |
| UnBlocation not on record | 1 |
| UEMlocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Maringá, BR | 1 |
| South China Normal Universitylocation not on record | 1 |
| EFGlocation not on record | 1 |
| Guatemala City, GT | 1 |
| Madison, US | 1 |
| Unknownlocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Empresas Públicas de Medellín E.S.P. (EPM)location not on record | 1 |
| Dublin, IE | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| La Paz, BO | 1 |
| Nishihara, JP | 1 |
| Chengdu, CN | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Hudson, US | 1 |
| Loja, EC | 1 |
| Salamanca, ES | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| ASUlocation not on record | 1 |
| Göteborg, SE | 1 |
| Santarém, BR | 1 |
| Seropédica, BR | 1 |
| HACAMlocation not on record | 1 |
| Juriquilla, MX | 1 |
| Gump Stationlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| UNESP-RClocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| EL PASO, US | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Guangzhou, CN | 1 |
| Campo Grande, BR | 1 |
| UFRRJlocation not on record | 1 |
| Wuzhou, CN | 1 |
| University of Hamburglocation not on record | 1 |
| Edinburgh, GB | 1 |
| Flagstaff, US | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
198 institutions · 1 188 of 1 325 vouchered records shown · 136 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Annona squamosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 16.5–26.8
Seasonal swing summer↔winter16.5 °C
Max temp (day)25.6 °C 23.1–32.4
Min temp (night)12.2 °C 11.1–20.7
Precipitation9.60 mm/mo 9.00–109
Air humidity51.6 % 50.9–54.3
Moisture balance-66.4 mm/mo -96.8–-14.4
Vapour deficit1,007 Pa 903–1,828
Wind speed2.00 m/s 1.80–3.90
Cloud cover26.4 % 22.2–29.9
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.