Annona spraguei

Saff. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Annona

At a glance

Occurrence records94

Data sources8

Biological traits30

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Annona spraguei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF94 records

DNA & barcodingNCBIsequences

01Narrative

Annona spraguei is a species of plant in the Annonaceae family. It is endemic to Panama. It is threatened by habitat loss. Its pollen is shed as permanent tetrads.Walker JW (1971) Pollen Morphology, Phytogeography, and Phylogeny of the Annonaceae. Contributions from the Gray Herbarium of Harvard University, 202: 1-130.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf length323 mm

Leaf width127 mm

Plant height14.35 m

Plant height max17 m

Seed length8.3 mm

Seed mass38.37 mg

Seed width max3.9 mm

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Ldmc max367 mg/g

Ldmc min367 mg/g

Leaf dry-matter content (LDMC)347 mg/g

⚠ sources differ — TRY: 347 mg/g · GIFT: 367 mg/g

Leaf n24.77 mg/g

Leaf p1.7 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)18.77 mm²/mg

Wood density516 mg/cm³

Other traits2

Leaf thickness0.021 mm

Seed height max2.6 mm

03Chemical composition4 compounds

Compounds documented for Annona spraguei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Acetogenins4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Deacetyluvaricin	present	LOTUS
Guanacone	present	LOTUS
Motrilin	present	LOTUS
Rolliniastatin-2	present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona spraguei has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX437663.1 ↗236 bpPanama · 2018

ACGT

TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCCGGCTGGAGGGAGTGGGACGGTGCGCCCCCGATTG …

Annona spraguei voucher STRI:Corteva-SJWright-RS00021 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor20

Museum / vouchered74

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy7% within 1 km

≤100 m 1>10 km 13

14 georeferenced · 6 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 7≤10 km 6>10 km 6

20 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	20
Universidad de Antioquia (UdeA)location not on record	13
Universidad Católica de Oriente (UCO)location not on record	5
Universidad Nacional de Colombia (UNAL)location not on record	5
Mexico City, MX	2
Fundación Desarrollo y Ambiente FUNDAlocation not on record	2
Mexico City, MX	2
University of Stellenboschlocation not on record	2
ASUlocation not on record	2
Tuxtla Gutiérrez, MX	1
HUAlocation not on record	1
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	1
WCS Colombialocation not on record	1
Universidad Industrial de Santander (UIS)location not on record	1

14 institutions · 58 of 74 vouchered records shown · 16 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)