Annona reticulata
speciesAt a glance
Occurrence records4 206
Data sources16
Biological traits115
DNA specimens17
eDNA detections9
Sources16 archives
Databases and archives Annona reticulata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 206 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources115 traits
Chemical compositionFooDB · LOTUS · NPASS5 751 compounds
Occurrence & distributionGBIF4 206 records
Environmental DNA1 datasets · 3 countries9 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB · GoaT978 Mbp
01Narrative
Annona reticulata est une espèce de plantes à fleurs du genre Annona, originaire d'Amérique tropicale. Ce petit arbre fruitier est appelé en français cachiman, corossolier réticulé ou encore anone cœur de bœuf et cœur de bœuf tout court.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology17
Fruit length60 mm
Fruit width52.5 mm
Leaf length145 mm
⚠ sources differ — AusTraits: 145 mm · GIFT: 195 mm
Leaf length max300 mm
Leaf length min90 mm
Leaf width52.5 mm
Leaf width max70 mm
Leaf width min35 mm
Petiole length1.5 cm
Plant height7.37 m
⚠ sources differ — GIFT: 7.37 m · AusTraits: 8 m · USDA: 6.1 m · TRY: 7.01 m
Plant height max5 m
Plant height min1 m
Seed length10 mm
Seed mass217 mg
⚠ sources differ — TRY: 217 mg · GIFT: 239 mg
Seed mass max239 mg
Seed mass min239 mg
Seed width5.5 mm
Life cycle & reproduction23
Bloom periodSummer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal type detailedanthropochorous
Flower colourgreen
Flower conspicuousYes
Flowering timennnnnnnnnnny
Fruit seed period beginFall
Fruit seed period endSpring
Life formtree
Life spanperennial
Lifespan categoryShort
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seedling vigorMedium
Diet & foraging1
Parasiteindependent
Habitat & environment30
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsNo
Aquaticterrestrial
BloatNone
Climatewet tropical
Climberself-supporting
Elevation max1 900 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage textureCoarse
Fruit colourred
Fruit fleshinessfleshy
Fruit typesyncarp
Growth formtree
Growth form USDASingle Crown
Habitat GIFTforest
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapelanceolate narrowly_elliptical oblong
Low growing grassNo
Root depth min36 in
Shape and orientationIrregular
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry23
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min365 days
Leaf C:N ratio12.88 g/g
Leaf c460 mg/g
Leaf dry-matter content (LDMC)307 mg/g
Leaf n35.04 mg/g
Leaf p1.42 mg/g
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max98 in
Precipitation min32 in
Shade toleranceHigh
Specific leaf area (SLA)31.58 mm²/mg
Temperature min40 °F
Wood density534 mg/cm³
Uses & economy15
Berry nut seed productYes
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productLow
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productYes
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr7.92 m
Planting density max640 per acre
Planting density min320 per acre
03Chemical composition5 751 compounds
Compounds documented for Annona reticulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Acetogenins75
Aminoacids70
Glycerophospholipids57
Cinnamic acids and derivatives30
Aporphine alkaloids $ Isoquinoline alkaloids27
Documented compounds5 751 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Potassium | 1,305.5 mg/100g | FooDB | |
| Anonaine | 120 mg/100g | FooDB | |
| epsilon-Polylysine | 83.5 mg/100g | FooDB | |
| Phosphorus | 81.1 mg/100g | FooDB | |
| L-Ascorbic acid | 77.5 mg/100g | FooDB | |
| Calcium | 72.3 mg/100g | FooDB | |
| Retinol | 33 IU | FooDB |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona reticulata has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes4
GenBank sequences10
eDNA detections9
Countries3
The DNA barcodea real sequence read deposited for this species
GCAGCATTCCGAGTAACCCCTCAACCTGGAGTTCCGCCCGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACA …
Annona reticulata isolate Ret3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL8★rbcLa★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Annona reticulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size978 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Annona reticulata0.98 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–282n range14median14mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 149×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol1 · CCDB · eflora +3
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-indian_vol1 — Kumar, L.S.S. & Ranadive, K. 1941 ; Asana, J.J. & Adatia, R.D. 1945; Pawar, M.S. et at. 1956 ; Thakur, D.R. & Singh, R.N. 1969 ; Bawa, K.S. 1973
CCDB · eflora
CCDB · book-fedorov — Kumar L. S., Ranadivc 1941
CCDB · book-fedorov — Asana, Adatia 1945
CCDB · book-fedorov — Pawar et al; 1956
CCDB · book-atlas-flowering-plants — Asana & A. 1945,
CCDB · kew — Ohri D, Kumar A. 1986. Nuclear DNA amounts in some tropical hardwoods. Caryologia 39: 303-307.
2n 162×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Bowden, W.M. 1945a, 1948
CCDB · book-fedorov — Bowden 1945a, 1948
2n 282×GoaT · Kew Plant DNA C-values Database · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Morawetz W, Samuel R. (pers. comm. 1998).
n 71×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — BAWA, K.S. 1973. Chromosome numbers of tree species of a lowland tropical community. J. Arnold Arbor. 54: 422-434.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 206 records
Wild obs. + sensor2 760
Museum / vouchered1 436
Cultivated / captive8
Other2
Origin
Native2
Introduced5
Range
Area of Occupancy AOO4 992 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy65% within 1 km
≤100 m 202≤1 km 33≤10 km 74>10 km 54
363 georeferenced · 2 397 without coordinates
Open the mapobservation + sensor2 760
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy89% within 1 km
≤100 m 384≤1 km 22≤10 km 43>10 km 8
457 georeferenced · 979 without coordinates
Open the institutions mapphysical evidence1 436
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 8 records without
Open the mapnot free-living8
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions68 of 142 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 223 |
| Saint Louis, US | 217 |
| Mexico City, MX | 95 |
| Mérida, MX | 59 |
| National Biodiversity Institute, Costa Ricalocation not on record | 45 |
| Bronx, US | 44 |
| Antiguo Cuscatlán, SV | 39 |
| Beijing, CN | 33 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 29 |
| Kunming, CN | 22 |
| León, NI | 20 |
| University of Stellenboschlocation not on record | 19 |
| Autlán de Navarro, MX | 19 |
| Berlin, DE | 18 |
| Tapachula, MX | 17 |
| Tuxtla Gutiérrez, MX | 15 |
| Mexico City, MX | 15 |
| Chapingo, MX | 14 |
| Salvador, BR | 14 |
| Baroda, IN | 11 |
| Tuxtla Gutiérrez, MX | 11 |
| Brisbane, AU | 9 |
| Kew, GB | 9 |
| CASlocation not on record | 8 |
| MeiseBGlocation not on record | 8 |
| MEXUlocation not on record | 8 |
| Chicago, US | 7 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 7 |
| San Francisco de Campeche, MX | 7 |
| Giardini Botanici Hanburylocation not on record | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| San José, CR | 6 |
| UFBAlocation not on record | 6 |
| Kensington, AU | 5 |
| Culiacán, MX | 5 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 5 |
| Uniwersytet Jagiellońskilocation not on record | 5 |
| Austin, US | 4 |
| HEMlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Palmerston, AU | 4 |
| Museo de Historia Natural de El Salvadorlocation not on record | 4 |
| South Kensington, GB | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| St. Augustine, TT | 4 |
| Honolulu, US | 4 |
| ASUlocation not on record | 3 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 3 |
| BISHlocation not on record | 3 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| MAlocation not on record | 3 |
| Universidad Católica de Oriente (UCO)location not on record | 3 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 3 |
| Philadelphia, US | 3 |
| Tlalnepantla, MX | 3 |
| Moscow State Universitylocation not on record | 3 |
| Forest Herbarium Ibadan (FHI)location not on record | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Pondicherry, IN | 3 |
| CNF-UFHBlocation not on record | 3 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Mérida, MX | 2 |
| CJBGlocation not on record | 2 |
| Canberra, AU | 2 |
| Chaguaramas, TT | 2 |
| USP-IBlocation not on record | 2 |
| HNBlocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| San Diego, US | 2 |
| Wayland Universitylocation not on record | 2 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Guangzhou, CN | 2 |
| Guatemala, GT | 2 |
| Riverside, US | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Montecillo, Texcoco, MX | 2 |
| Taipei, TW | 2 |
| GB | 2 |
| Madison, US | 2 |
| Glocation not on record | 2 |
| Mexico City, MX | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Instituto do Meio Ambientelocation not on record | 1 |
| Yangling, CN | 1 |
| Miami, US | 1 |
| Wlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| Anchorage, US | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| LDlocation not on record | 1 |
| Guatemala City, GT | 1 |
| Zapopan, MX | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| La Paz, BO | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| UnBlocation not on record | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| Plocation not on record | 1 |
| St. Paul, US | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| OTSlocation not on record | 1 |
| Puebla, MX | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Mount Annan, AU | 1 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 1 |
| Ciudad de México, MX | 1 |
| Paris, FR | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| James Cook Townsvillelocation not on record | 1 |
| Salamanca, ES | 1 |
| Yaoundé, CM | 1 |
| Guasave, MX | 1 |
| Juriquilla, MX | 1 |
| San Francisco, US | 1 |
| UFRPElocation not on record | 1 |
| Göteborg, SE | 1 |
| Tampa, US | 1 |
| UNESP-FCAlocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| UNIVASFlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| URCAlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Guilin, CN | 1 |
| Puerto Ayora, EC | 1 |
| University of Hamburglocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
142 institutions · 1 273 of 1 436 vouchered records shown · 162 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Annona reticulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 23.4–25.7
Seasonal swing summer↔winter6.30 °C
Max temp (day)27.7 °C 27.7–30.5
Min temp (night)19.9 °C 18.6–24.1
Precipitation140 mm/mo 76.5–274
Air humidity58.5 % 51.0–69.9
Moisture balance16.1 mm/mo -48.0–105
Vapour deficit1,196 Pa 989–1,616
Wind speed2.30 m/s 1.60–2.90
Cloud cover35.7 % 21.2–46.9
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.