Annona pittieri — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Annona

At a glance

Occurrence records222

Data sources7

Biological traits11

DNA specimens2

eDNA detections0

Sources7 archives

Databases and archives Annona pittieri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility222 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF222 records

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Annona pittieri is a species of plant in the family Annonaceae. It is native to Costa Rica and Panamá. John Donnell Smith, the American taxonomist who first formally described the species, named it after Henri François Pittier, the Swiss botanist who collected specimen he examined.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona pittieri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX663896.1 ↗510 bp

ACGT

ATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACCCCTCAACCTGGAGTTCCGCCCGAGGAAGCAGGGG …

Annona pittieri isolate Apit1_cr ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL3

plant barcode

08Occurrence & distribution

Record type222 records

Wild obs. + sensor21

Museum / vouchered201

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 18≤1 km 1

19 georeferenced · 2 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	74
Museo Nacional de Costa Rica (MNCR)location not on record	36
Saint Louis, US	36
Kew, GB	7
San José, CR	6
Mexico City, MX	4
South Kensington, GB	4
BMlocation not on record	3
MAlocation not on record	3
Chicago, US	3
CJBGlocation not on record	2
MEXUlocation not on record	2
Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record	2
Tuxtla Gutiérrez, MX	1
University of Stellenboschlocation not on record	1
Provincial Museum of Albertalocation not on record	1

16 institutions · 185 of 201 vouchered records shown · 16 without an institution code