Annona muricata
speciesAt a glance
Occurrence records4 167
Data sources15
Biological traits125
DNA specimens9
eDNA detections7
Sources15 archives
Databases and archives Annona muricata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 167 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics9 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources125 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS6 060 compounds
Occurrence & distributionGBIF4 167 records
Environmental DNA1 datasets · 1 countries7 detections
DNA & barcodingBOLD · NCBI9 specimens
Genome at a glanceCCDB2n = 14
01Narrative
Annona muricata, le Corossolier, est une espèce de plantes à fleurs de la famille des Annonaceae. C'est un petit arbre originaire du nord de l'Amérique du Sud, cultivé dans les régions tropicales pour son fruit comestible, le corossol. Le terme « corossol » est aussi utilisé pour désigner l'arbre.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology25
Fruit length max300 mm
Fruit width max150 mm
Leaf length115 mm
Leaf length max200 mm
Leaf length min50 mm
Leaf size9 500 mm²
Leaf width45 mm
Leaf width max70 mm
Leaf width min20 mm
Petiole length0.5 cm
Plant height7.03 m
⚠ sources differ — GIFT: 7.03 m · AusTraits: 8 m · USDA: 6.1 m · TRY: 8.03 m
Plant height max9 m
Plant height min7.5 m
Seed length17.5 mm
⚠ sources differ — TRY: 17.5 mm · AusTraits: 16 mm
Seed length max17 mm
Seed length min13 mm
Seed mass396 mg
Seed mass max470 mg
Seed mass min322 mg
Seed volume440 mm³
Seed volume max440 mm³
Seed volume min440 mm³
Seed width9.5 mm
Seed width max10 mm
Seed width min9 mm
Life cycle & reproduction27
Bloom periodSummer
Coppice potentialNo
Deciduousnessvariable
⚠ sources differ — TRY: deciduous/evergreen · GIFT: evergreen
Dispersal type detailedanthropochorous
Flower colourgreen
⚠ sources differ — GIFT: green · USDA: Yellow
Flower conspicuousYes
Fruit seed period beginFall
Fruit seed period endFall
Growth rate USDAModerate
Life formtree
Life spanperennial
Lifespan categoryShort
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateSlow
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatewet tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage textureMedium
Fruit colourgreen
Fruit fleshinessfleshy
Fruit typesyncarp
Growth formtree
Growth form USDASingle Stem
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionYes
Leaf shapeelliptical obovate
Low growing grassNo
Root depth min60 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry22
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min365 days
Leaf c480 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max90 in
Precipitation min60 in
Salinity toleranceLow
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5 pH
Temperature min17 °F
Wood density364 mg/cm³
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousYes
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr6.1 m
Planting density max700 per acre
Planting density min300 per acre
03Chemical composition6 060 compounds
Compounds documented for Annona muricata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Acetogenins309
Aminoacids70
Glycerophospholipids57
Cinnamic acids and derivatives46
Wax monoesters26
Documented compounds6 060 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sugars | 13,540 mg/100g | FooDB | |
| D-Mannose | 6,370 mg/100g | FooDB | |
| D-Fructose | 5,940 mg/100g | FooDB | |
| Potassium | 1,927.5 mg/100g | FooDB | |
| Maltose | 760 mg/100g | FooDB | |
| Nitrogen | 270 mg/100g | FooDB | |
| epsilon-Polylysine | 189 mg/100g | FooDB | |
| Phosphorus | 180.5 mg/100g | FooDB |
05DNA & barcoding9 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona muricata has left across the world's sequence archives.
At a glance
DNA specimens9
Marker genes2
GenBank sequences10
eDNA detections7
Countries2
The DNA barcodea real sequence read deposited for this species
GAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACCCCTCAACCTGGAGTT …
Annona muricata isolate MX-PH ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL9
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Annona muricata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–162n range14median14mode11records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 149×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Datta, P. C. & B. De. 1990. Karyology of some Indian Annonaceae. Cytologia 55: 187–196.
CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.
CCDB · book-ipcn72 — TANAKA, R., & H. OKADA. 1972. Karyological studies in four species of Annonaceae, a primitive Angiosperm. J. Sci. Hiroshima Univ. Ser. B, Div. 2, 14: 85-105.
CCDB · book-indian_vol1 — Kumar, L.S.S. & Ranadive, K. 1941 ; Delay, C. 1947; Simmonds, N.W. 1954; Pawar, M.S. eta!. 1956; Tanaka, R. & Okada, H. 1972
CCDB · book-fedorov — Kumar L. S., Ranadive 1941
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Simmonds 1954
CCDB · book-fedorov — Pawar et al. 1956
CCDB · book-atlas-flowering-plants — Kumar & R. 1941,
2n 162×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Bowden, W.M. 1945a, 1948; Sarkar, A.K., Chakraverty, M. et at. 1980; Sobha, V. & Ramachandran, K. 1980
CCDB · book-fedorov — Bowden 1945a, 1948
n 82×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sarkar, A. K., M. Chakraverty, S. K. DAS, C. R. Pal & D. Hazara. 1980. In Chromosome number reports LXVII. Taxon 29: 358–360.
CCDB · ipcn-api-dl — Sobha, V. & K. RAMACHANDRAN. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 165–166.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 167 records
Wild obs. + sensor2 490
Museum / vouchered1 573
Cultivated / captive94
Other10
Origin
Native24
Introduced7
Range
Area of Occupancy AOO9 964 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 971≤1 km 239≤10 km 189>10 km 82
1 481 georeferenced · 1 009 without coordinates
Open the mapobservation + sensor2 490
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy74% within 1 km
≤100 m 165≤1 km 47≤10 km 56>10 km 18
286 georeferenced · 1 287 without coordinates
Open the institutions mapphysical evidence1 573
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy88% within 1 km
≤100 m 22≤10 km 3
25 georeferenced · 69 without coordinates
Open the mapnot free-living94
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions97 of 215 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 116 |
| Bronx, US | 73 |
| Durango, MX | 65 |
| Chapingo, MX | 38 |
| Leiden University Medical Centerlocation not on record | 36 |
| Mexico City, MX | 23 |
| Mérida, MX | 21 |
| Puerto Ayora, EC | 20 |
| University of Stellenboschlocation not on record | 19 |
| Salvador, BR | 18 |
| Universidad de Caldas (UCaldas)location not on record | 18 |
| National Biodiversity Institute, Costa Ricalocation not on record | 16 |
| Universidad de Antioquia (UdeA)location not on record | 16 |
| Laboratorio de Ictiologialocation not on record | 16 |
| UFBAlocation not on record | 15 |
| Kunming, CN | 14 |
| Tapachula, MX | 14 |
| Beijing, CN | 12 |
| Universidad del Valle (UV)location not on record | 12 |
| Universidad Nacional de Colombia (UNAL)location not on record | 11 |
| Kew, GB | 11 |
| Chaguaramas, TT | 11 |
| León, NI | 11 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 11 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 11 |
| QCNElocation not on record | 10 |
| Santa Cruz de la Sierra, BO | 10 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 10 |
| Chicago, US | 10 |
| Loja, EC | 9 |
| UEPAlocation not on record | 9 |
| MeiseBGlocation not on record | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| Toluca, MX | 7 |
| Instituto do Meio Ambientelocation not on record | 7 |
| Ilhéus, BR | 7 |
| Departamento de Sistematica e Ecologialocation not on record | 7 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 7 |
| Smithfield, AU | 6 |
| Universidad de Nariño (UdeNar)location not on record | 6 |
| Riverside, US | 6 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 6 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Guatemala, GT | 5 |
| St. Augustine, TT | 5 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 5 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 5 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 5 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 5 |
| Mexico City, MX | 5 |
| JBRJlocation not on record | 5 |
| Paris, FR | 5 |
| CNF-UFHBlocation not on record | 5 |
| Universidad Católica de Oriente (UCO)location not on record | 5 |
| Honolulu, US | 5 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Altos de Pipe, VE | 4 |
| Moscow State Universitylocation not on record | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| Cochabamba, BO | 4 |
| Masindi, UG | 4 |
| Canberra, AU | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| Université de Strasbourglocation not on record | 4 |
| UNEMATlocation not on record | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Blumenau, BR | 4 |
| Miami, US | 4 |
| LDlocation not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| Antiguo Cuscatlán, SV | 4 |
| UFOPlocation not on record | 4 |
| Fortaleza, BR | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| Université de Bordeauxlocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| Aarhus, DK | 3 |
| Pondicherry, IN | 3 |
| Xiamen, CN | 3 |
| URCAlocation not on record | 3 |
| MAlocation not on record | 3 |
| Stockholm, SE | 3 |
| Universidade Federal do Maranhãolocation not on record | 3 |
| Yaoundé, CM | 3 |
| LSF/FSA/UAClocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| WAGlocation not on record | 3 |
| Cuiabá, BR | 3 |
| Londrina, BR | 3 |
| CEPLAClocation not on record | 3 |
| Quito, EC | 3 |
| Madison, US | 3 |
| UNIVASFlocation not on record | 3 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| UFVJMlocation not on record | 3 |
| Universidade Federal de Juiz de Foralocation not on record | 3 |
| BISHlocation not on record | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Taipei, TW | 2 |
| South Kensington, GB | 2 |
| Mexico City, MX | 2 |
| UFRPElocation not on record | 2 |
| Universidade Federal do Vale do São Franciscolocation not on record | 2 |
| Uberlândia, BR | 2 |
| UFPElocation not on record | 2 |
| College Park, US | 2 |
| Vancouver, CA | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Campo Grande, BR | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| UEMAlocation not on record | 2 |
| UFMSlocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| San José, CR | 2 |
| Tampa, US | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Guilin, CN | 2 |
| Autlán de Navarro, MX | 2 |
| Ulocation not on record | 2 |
| UTPLlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Auckland, NZ | 2 |
| Christchurch, NZ | 2 |
| Station d'Ecologie de Lamtolocation not on record | 2 |
| US | 2 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Wlocation not on record | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| UNESClocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Criciúma, BR | 1 |
| Feira de Santana, BR | 1 |
| San Diego, US | 1 |
| UFPIlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Fredericksburg, US | 1 |
| CASlocation not on record | 1 |
| Long Beach, US | 1 |
| Ojo, NG | 1 |
| Montréal, CA | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| UFPRlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Chengdu, CN | 1 |
| HAWlocation not on record | 1 |
| GB | 1 |
| Tlalnepantla, MX | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Teresina, BR | 1 |
| UnBlocation not on record | 1 |
| arosemena tola, EC | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Richmond, US | 1 |
| La Paz, BO | 1 |
| Ciudad de México, MX | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| Austin, US | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Dresden, DE | 1 |
| UNISANTAlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| Universidad Icesi (ICESI)location not on record | 1 |
| Wayland Universitylocation not on record | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| HUENFlocation not on record | 1 |
| Guatemala City, GT | 1 |
| Hudson, US | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| CJBGlocation not on record | 1 |
| University of Calabar/Department of Plant and Ecological Studies Herbariumlocation not on record | 1 |
| HNBlocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Philadelphia, US | 1 |
| Riobamba, EC | 1 |
| UFESlocation not on record | 1 |
| Santarém, BR | 1 |
| Porto Velho, BR | 1 |
| Brasília, BR | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| INBIOlocation not on record | 1 |
| UEMlocation not on record | 1 |
| Brasília, BR | 1 |
| LBVlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Barcelona, ES | 1 |
| Cruz das Almas, BR | 1 |
| EL PASO, US | 1 |
| Cenargenlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Dublin, IE | 1 |
| Cincinnati, US | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| UESBlocation not on record | 1 |
| Hobart, AU | 1 |
| UNIVILLElocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| UFAClocation not on record | 1 |
| Ann Arbor, US | 1 |
| Frankfurt am Main | 1 |
215 institutions · 1 130 of 1 573 vouchered records shown · 443 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Annona muricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median26.4 °C 22.8–30.0
Seasonal swing summer↔winter10.6 °C
Max temp (day)32.8 °C 28.7–36.9
Min temp (night)19.8 °C 17.4–22.1
Precipitation1.60 mm/mo 1.40–1.80
Air humidity45.7 % 43.4–48.0
Moisture balance-156 mm/mo -186–-126
Vapour deficit1,952 Pa 1,464–2,440
Wind speed2.90 m/s 2.90–3.00
Cloud cover13.4 % 12.2–14.6
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.