Annona longiflora

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Annona

At a glance

Occurrence records143

Data sources6

Biological traits11

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Annona longiflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF143 records

DNA & barcodingNCBIsequences

01Narrative

Annona longiflora is a species of plant in the family Annonaceae. It is endemic to Mexico.. Sereno Watson, the American botanist who first formally described the species, named it after its long ( in Latin) flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height2 m

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Tree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona longiflora has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW374676.1 ↗340 bpMexico

ACGT

GCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCTCGCATCGCGTCACCCCCTCCCCGATCCTCGTGAGCGGGTGCGGGGG …

Annona longiflora voucher IBUG:141364 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type143 records

Wild obs. + sensor13

Museum / vouchered130

Range

Area of Occupancy AOO376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 1

10 georeferenced · 3 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 76≤1 km 1≤10 km 10>10 km 2

89 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence130

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	35
Mexico City, MX	17
Giardini Botanici Hanburylocation not on record	15
Mexico City, MX	11
Saint Louis, US	11
Zacatecas, MX	9
Autlán de Navarro, MX	8
Phoenix, US	7
Austin, US	5
Mexico City, MX	2
MEXUlocation not on record	2
Mérida, MX	2
CASlocation not on record	1
Dekalb, US	1
University of Stellenboschlocation not on record	1
ASUlocation not on record	1
Universidad de Autonoma de Baja Californialocation not on record	1

17 institutions · 129 of 130 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)