Annona hayesii

Saff. ex Standl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Annona

At a glance

Occurrence records33

Data sources7

Biological traits16

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Annona hayesii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF33 records

DNA & barcodingNCBIsequences

01Narrative

Annona hayesii là loài thực vật có hoa thuộc họ Na. Loài này được Saff. mô tả khoa học đầu tiên năm 1925.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height8.79 m

Seed mass57.05 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density498 mg/cm³

03Chemical composition13 compounds

Compounds documented for Annona hayesii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Aporphine alkaloids $ Isoquinoline alkaloids9

Anthraquinones and anthrones1

Aporphine alkaloids1

Isoquinoline alkaloids1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Norushinsunine	present	LOTUS
(-)-Nuciferine	present	LOTUS
(12S)-16-methoxy-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaen-17-ol	present	LOTUS
(12S)-18-methoxy-5,7-dioxa-13-azapentacyclo[10.7.1.02,10.04,8.016,20]icosa-1(20),2,4(8),9,16,18-hexaen-19-ol	present	LOTUS
4-Methylbenzo(g)quinoline-5,10-dione	present	LOTUS
5',6'-Dimethoxy-2',3',8',8a'-tetrahydro-1'h,4h-spiro[cyclohexa-2,5-diene-1,7'-cyclopenta[ij]isoquinolin]-4-one	present	LOTUS
5,10-Dimethoxy-4-methylbenzo[g]quinoline	present	LOTUS
Anonaine	present	LOTUS
Liriodenine	present	LOTUS
Lysicamine	present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona hayesii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMZ478781.1 ↗553 bpPanama

ACGT

AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGC …

Annona hayesii voucher K1349_A4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor11

Museum / vouchered22

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1>10 km 2

3 georeferenced · 8 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 2≤10 km 4>10 km 3

9 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	6
Universidad de Antioquia (UdeA)location not on record	5
Universidad de Caldas (UCaldas)location not on record	2
Universidad Industrial de Santander (UIS)location not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	1
Museo Nacional de Costa Rica (MNCR)location not on record	1

7 institutions · 17 of 22 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)