Annona acuminata

Saff. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Annona

At a glance

Occurrence records65

Data sources7

Biological traits22

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Annona acuminata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF65 records

DNA & barcodingNCBIsequences

01Narrative

Annona acuminata is a species of plant in the Annonaceae family. It is native to Panama, and Colombia. William Edwin Safford, the American botanist who first formally described the species, named it after the tapering ( in Latin) tips of its leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height9.09 m

Plant height max8 m

Seed mass36.44 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry7

Ldmc max344 mg/g

Ldmc min344 mg/g

Leaf dry-matter content (LDMC)332 mg/g

Leaf n22.97 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)18.06 mm²/mg

Wood density654 mg/cm³

03Chemical composition3 compounds

Compounds documented for Annona acuminata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aporphine alkaloids $ Isoquinoline alkaloids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
Liriodenine	present	LOTUS
Lysicamine	present	LOTUS
O-Methylmoschatoline	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annona acuminata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLGQ981664.1 ↗553 bpPanama · 2007

ACGT

AGTATTTTTTTCAAAGCGGGTGTTAAAGAGTACAAATTGAATTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCA …

Annona acuminata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor1

Museum / vouchered64

Origin

Native3

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 5≤10 km 9>10 km 1

15 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	22
Universidad de Antioquia (UdeA)location not on record	8
Universidad Nacional de Colombia (UNAL)location not on record	4
Mexico City, MX	3
Universidad Tecnológica del Chocó (UTCH)location not on record	3
Museo Nacional de Costa Rica (MNCR)location not on record	3
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Chicago, US	2
National Biodiversity Institute, Costa Ricalocation not on record	2
Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
Provincial Museum of Albertalocation not on record	1

13 institutions · 54 of 64 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)