Annella mollis

(Nutting, 1910) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Malacalcyonacea/Subergorgiidae/Annella

At a glance

Occurrence records924

Data sources10

Biological traits4

DNA specimens19

eDNA detections2

Sources10 archives

Databases and archives Annella mollis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility778 records↗

OBISOcean Biodiversity Information System146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS · NPASS61 compounds

Occurrence & distributionGBIF · OBIS924 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD19 specimens

01Narrative

Annella mollis (Subergorgia mollis) is a species of soft corals belonging to the family Subergorgiidae. They live in areas in the Indo-West Pacific, around 12 to 18 meters deep, in lower reef slopes, on rocks and sand substrates.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max18 m

Depth min12 m

03Chemical composition61 compounds

Compounds documented for Annella mollis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Spirostane steroids19

Cembrane diterpenoids8

Furostane steroids8

Disaccharides $ Polysaccharides3

Pregnane steroids2

Documented compounds61 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Dioscin	present	NPASS
(1S,2E,4R,8S,11S,12R)-4,12-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[9.3.1]pentadec-2-en-6-one	present	NPASS
(1S,2E,4S,8S,11R,12S)-4,11-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[10.2.1]pentadec-2-en-6-one	present	NPASS
(1S,2E,4S,8S,11S,12R)-4,12-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[9.3.1]pentadec-2-en-6-one	present	NPASS
(1S,4S)-5-methoxy-4,7-dimethyl-1-propan-2-yl-1,2,3,4-tetrahydronaphthalene	present	LOTUS
(25S)-3beta-spirostan-5-ene-3-ol-3-O-alpha-L-rhamnopyranosyl-(1->2)-[alpha-L-rhamnopyranosyl-(1->4)]-beta-D-glucopyranoside	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(1S,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(2R)-4-[(1S,2S,4S,6S,7S,8R,9S,12S,13R,16S)-6-hydroxy-7,9,13-trimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-6-yl]-2-methylbutoxy]oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(2S)-4-[(1S,2S,4S,6S,7S,8R,9S,12S,13R,16S)-6-hydroxy-7,9,13-trimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-6-yl]-2-methylbutoxy]oxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[(1S,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annella mollis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P696 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATGAACAAATATCTTACACGTTGGTTATTTTCTACTAATCATAAGGATATAGGTACTTTATATTTACTATTTGGTGCTTTTTCTGGGATG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leptogorgia albasame order3.0%Leptogorgia cofrinisame order3.0%Paramuricea placomussame order5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_061995 ↗ · 14 protein · 1 tRNA · 2 rRNA

ND2ND5ND4COX3ATP6ATP8COX2COX1ND1CYTBND6ND3ND4LmutSrnlrns

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type924 records

Wild obs. + sensor682

Museum / vouchered238

Other4

Range

Area of Occupancy AOO1 912 km²

Depth

0–200 m sunlit75

200–1000 m twilight12

1–4 km midnight13

>4 km abyssal0

median 25 m · max 3 335 m · 100 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 116≤1 km 182≤10 km 87>10 km 37

422 georeferenced · 260 without coordinates

Open the mapobservation + sensor682

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 67≤1 km 18≤10 km 6

91 georeferenced · 147 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	39
Museum and Art Gallery of the Northern Territorylocation not on record	25
Washington, US	24
CASlocation not on record	16
Queensland Museumlocation not on record	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
BIKlocation not on record	4
Sydney, AU	3
Paris, FR	1

9 institutions · 134 of 238 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Annella mollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)