Annametra occidentalis

(AH Clark, 1915) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Crinoidea/Comatulida/Antedonidae/Annametra

At a glance

Occurrence records30

Data sources7

Biological traits0

DNA specimens10

eDNA detections7

Sources7 archives

Databases and archives Annametra occidentalis's data was compiled from.

GBIFGlobal Biodiversity Information Facility28 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS30 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Annametra occidentalis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes4

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

1Gmostly conserved

283Tmostly conserved

GAATTGGTTAATACCTTTAATGATAGGTGCTCCTGATTTAGCTTTTCCTCGTGTAAAAAAAATGAGTTTTTGACTTCTTCCTCCATCTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pontiometra andersonisame order7.8%Stephanometra tenuipinnasame order9.4%Cenometra emendatrixsame order9.7%Cenometra bellasame order9.8%Dichrometra flagellatasame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S28S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type30 records

Wild obs. + sensor4

Museum / vouchered26

Range

Area of Occupancy AOO84 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 15 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 3 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	7
Paris, FR	1
Royal Museum for Central Africalocation not on record	1
Brussels, BE	1
Los Angeles, US	1
RBINS-Scientific Heritagelocation not on record	1

6 institutions · 12 of 26 vouchered records shown · 12 without an institution code

09Environmental DNA7 detections

Where the DNA of Annametra occidentalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Rocky Reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 18.2–25.5

Seasonal swing summer↔winter5.60 °C

Max temp (day)22.2 °C 19.7–26.6

Min temp (night)18.6 °C 16.7–24.1

Precipitation44.7 mm/mo 27.5–137

Air humidity61.4 % 60.4–62.1

Vapour deficit943 Pa 827–1,228

Cloud cover15.0 % 12.9–31.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)