Anisosticta bitriangularis

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Coccinellidae/Anisosticta

At a glance

Occurrence records942

Data sources8

Biological traits0

DNA specimens43

eDNA detections41

Sources8 archives

Databases and archives Anisosticta bitriangularis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.33 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF942 records

Environmental DNA1 datasets · 2 countries41 detections

DNA & barcodingBOLD43 specimens

Genome at a glanceGoaT333 Mbp

01Narrative

Anisosticta bitriangularis, known generally as the marsh lady beetle or swamp lady beetle, is a species of lady beetle in the family Coccinellidae. It is found in Europe and Northern Asia (excluding China) and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisosticta bitriangularis has left across the world's sequence archives.

At a glance

DNA specimens43

BINs3

Marker genes1

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

13Cmostly conserved

14Cmostly conserved

15Tmostly conserved

16Amostly conserved

17Tmostly conserved

19Tmostly conserved

20Gmostly conserved

22Tmostly conserved

23Amostly conserved

24Tmostly conserved

25Amostly conserved

26Tmostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Gmostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Tmostly conserved

50Cmostly conserved

53Amostly conserved

54Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

61Amostly conserved

62Amostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Gmostly conserved

72Amostly conserved

74Cvariable

75Tmostly conserved

76Amostly conserved

92Tmostly conserved

103Cmostly conserved

181Gmostly conserved

196Amostly conserved

220Tmostly conserved

235Tmostly conserved

250Tmostly conserved

262Amostly conserved

271Cmostly conserved

304Amostly conserved

316Amostly conserved

337Gmostly conserved

373Tmostly conserved

385Tmostly conserved

427Tmostly conserved

428Tvariable

436Cvariable

469Gmostly conserved

478Gmostly conserved

482Amostly conserved

496Cmostly conserved

499Cmostly conserved

544Amostly conserved

581Cmostly conserved

619Tmostly conserved

631Amostly conserved

646Tmostly conserved

AACTTTATATTTCCTATTTGGTATATGAGCTGGAATAGTAGGGACTTCTCTAAGAATATTAATTCGGTTAGAACTAGGATCCGCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes7

BINs3

Most divergent pair4.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisosticta borealissame genus5.3%Anisosticta novemdecimpunctatasame genus6.5%Macronaemia episcopalissame family9.9%Coelophora inaequalissame family13.6%Coelophora biplagiatasame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anisosticta bitriangularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size332 520 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anisosticta bitriangularis0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type942 records

Wild obs. + sensor246

Museum / vouchered696

Origin

Native7

Range

Area of Occupancy AOO1 900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 141≤1 km 34≤10 km 7>10 km 15

197 georeferenced · 49 without coordinates

Open the mapobservation + sensor246

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 99≤1 km 49≤10 km 69>10 km 10

227 georeferenced · 469 without coordinates

Open the institutions mapphysical evidence696

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	97
Vancouver, CA	94
WIlocation not on record	82
University of Alberta Museums (UAM)location not on record	76
Chicago, US	65
Royal Saskatchewan Museumlocation not on record	64
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	33
Fairbanks Museum and Planetariumlocation not on record	28
OSUClocation not on record	22
Espace pour la vielocation not on record	21
Toronto, CA	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
McGill Universitylocation not on record	9
MIDDlocation not on record	9
University of Guelphlocation not on record	6
Cornell University Insect Collectionlocation not on record	6
Wuzhou, CN	5
Champaign, US	4
Lexington, US	3
Saint John, CA	3
Vernal, US	1
Universidad Católica de Manizaleslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

23 institutions · 653 of 696 vouchered records shown · 43 without an institution code

09Environmental DNA41 detections

Where the DNA of Anisosticta bitriangularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map2 countries0

b. spruce bogTemperate mixed forest1. Forest & Woodland | 1.1. Boreal Forest5. Wetlands (inland) | 5.4. Bogs, Marshes, S…Wetlandpond, emergent sedge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 6.20–18.1

Seasonal swing summer↔winter35.5 °C

Max temp (day)18.4 °C 12.8–22.4

Min temp (night)8.70 °C 0.4–15.7

Precipitation88.0 mm/mo 34.0–120

Air humidity57.9 % 53.6–62.6

Moisture balance-39.9 mm/mo -53.6–37.4

Vapour deficit650 Pa 426–855

Wind speed3.00 m/s 1.70–4.50

Cloud cover44.2 % 35.2–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)